Imagine you have been recently hired by a biotech company. On your first day of work, the manager wants to see your ability to engineer proteins, so they ask you to design a protein expression system for making any protein you wish, but it should have some way after expression in E. coli BL21 to be purified by affinity chromatography. The manager gives you some advice and recommends you produce the protein with a HisTag so you can purify your protein with nickel affinity column chromatography which the company uses regularly. To make things easier since its your first day, the manager gives you a tube containing a proprietary expression vector that only your company has called pET 14p and it is this vector that you will need to use to insert the gene for the protein that you choose to make and purify. Before getting started on the actual experiments, the manager wants you to design the experimental setup and provide a report. The following 6 items (marked w/ **) should be included in your report along with an explanation for each step. Steps to follow in this design project for your report 1) Choose a protein that you are interested in purifying. -This can be any protein (there are millions possible so no two students would by chance choose the same protein) - You can use resources like NCBI (https://www.ncbi.nlm.nih.gov/protein/ ) or KEGG (https://www.genome.jp/kegg/pathway.html), among others to find a protein you are interested in making. **(List the name of the protein you plan to make and the organism it comes from) 2) Find the amino acid sequence of that protein and then find the DNA sequence needed to make that amino acid sequence. -The amino acid sequence may be found at the links above. DNA sequences may be found at NCBI or KEGG as well or deduce it here: https://en.vectorbuilder.com/tool/codon-optimization.html **(List the amino acid sequence and its corresponding DNA sequence for this protein you plan to make) 3) Choose a set of restriction enzyme that you can use to cut your pET14p expression vector but that will not cut the important protein coding regions of the gene you are inserting into pET14p -NOTE: You should make sure that the coding sequence of your selected protein you choose does not already contain the sequences recognized by those restriction enzymes you selected to cut your pET14p vector or else it will cut your gene at a place you don't want. You can use this tool http://nc2.neb.com/NEBcutter2/ to check if your gene (DNA sequence that codes for your protein of interest when translated) contains the sequences recognized by that restriction enzyme that you have chosen. If the gene does contain a sequence that will be cut by your enzymes selected to cut the pET14p vector then you'll either have to choose a different enzyme or select a different codon for those positions on that gene so that it can make the same protein but not be cut improperly by the restriction enzymes you plan to use. Because you will be expressing your protein for purification using Nickel affinity chromatography, make sure that your choice of cutting location does not remove the HisTag sequence from your vector. **(List the names of the restriction enzymes you will use to cut the pET14p vector and their recognition sites. Also show where in the pET14p vector that it cuts) 4) Imagine you have access to the DNA template of this gene. Choose the appropriate forward primer and reverse primer that you will need to PCR this gene from your template. Make sure that your primers have 5' ends that possess the corresponding restriction sites needed to later insert the PCR product into your pET14p vector. - NOTE: You will need your primers to have approximately the same melting temperature (within 2 degrees of each other) and they should be between 55°C to 65°C. You may find this tool useful http://www.biophp.org/minitools/melting_temperature/demo.php (you can select basic Tm). Remember that your reverse primer sequence would be the reverse complement of the gene sequence you had chosen (if you are looking at the coding sequence in the proper way) and as such you may find the following tool useful for getting the reverse complement: http://www.bioinformatics.org/sms/rev_comp.html **(Provide the forward and reverse primer DNA sequences from 5' to 3' and their expected melting temperature...underline the restriction sites on each primer) 5) Show your plasmid containing the recombinant DNA for your gene. Imagine that you have now conducted the PCR successfully with your primers on your gene of interest to get a PCR product and that you have cut the PCR product using the same restriction enzymes from step 3 that you used to cut the vector. After ligating the cut PCR product into the cut pET14p vector you will have a complete plasmid. **(Show what the DNA sequence will look like for the ligated DNA of your final complete plasmid but just show the region between the T7 promoter and T7 terminator after you have ligated your gene into the vector making sure to underline the restriction sites and placing in bold (or highlight in yellow) the new sequence of your gene that you inserted into the vector) 6) Assume you have now transformed E. coli with this complete plasmid DNA including your gene and it worked to make the protein that you wanted. Show the protein sequence of your final product that would result from expression of this plasmid. **(Show the translated DNA sequence from step 5 so please show the amino acid sequence of what your expressed protein would be. Remember that it will need to included the His-tag in the same frame so you must check if your open reading frame makes sense. You can use an online translation tool like: https://web.expasy.org/translate/. Show what the amino acid sequence will look like if you were to express this protein by translating the region between the first Methionine after the Ribosome Binding Site until you reach the first stop codon). If you do see a stop codon prior to that then your reading frame is likely mis-aligned and you will nee to re-adjust your forward PCR primer to either include an additional nucleotide or two nucleotides to get your insert it into the correct reading frame with the rest of your pET 14p vector. This additional nucleotide (or two) can be placed between the restriction site and the start of your gene when designing your forward primer. PET-14p sequence landmarks T7 promoter T7 transcription start His Tag coding sequence Multiple cloning sites (KpnI - Spe I) T7 terminator pBR322 origin bla coding sequence 646-662 645 554-571 510-526 404-450 Sca (4156) 2845 Pvu I(4046) 3606-4463 Pst I(3921) Eam1105 I(3676). HgiE II(3369) AlwN I(3199) Aat II(4598) Ssp I(4480) EcoR I(4669) Apo I(4669) Cla I(24) Hind III(29) <j「3606-4463) ori (2845) Bpu1102 I(458) Nhe I(229) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) Sph 1(874) EcoN I(934) -Sal I(959) PshA I(1024) PET-14P (4671bp) Eag I(1247) Nru I(1282) ApaB I(1360) BspLU11 I(2783) Afl III(2783) Sap I(2667) Bst1107 I(2554) BsaA I(2535) Tth111 I(2528) BsmB I(2424) Pvu Il(2374) BspM I(1362) Bsm I(1667) Msc I(1754) Bpu10 I(1889) Bsg I(1943) PET 14p Nhe I(229) BglII T7 promoter primer #69348-3 T7 promoter Bpu1102 I(458) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) XbaI You can check the sequence recognized by the restriction sites by searching the names of the enzymes on http://www.neb.com/ rbs means the ribosome binding site ▶rbs AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAAC GGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA NcoI His Tag Spe I Ball KpnI TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCC TGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGC TAAC AAAGCCCGA MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuVal ProArgGlySerThrSerGlyGInVal ProA laAlaAsnLysAlaArg Bpu1102 I thrombin T7 terminator AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC TAAACGGGTCTTGAGGGGTTTTTTG LysGluAlaGluLeuAlaAlaAlaThгAlaGluGInEnd T7 terminator primer #69337-3 Same as above but text can be copied for your convenience: AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGCTAACAAAGCCCGA AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG