Solved: A) Analysis of gene X (20 Marks) The following DNA sequence has been i

Question

A) Analysis of gene X (20 Marks) The following DNA sequence has been identified and named 'gene X'. It is thought that this sequence codes for a single protein. Design 5' and 3' PCR primers that will amplify ONLY the open reading frame of the genes. Give these sequences in a 5' to 3' orientation. Include PstI and SacI restriction enzyme recognition sites on the 5' ends of the 5' and 3' primers respectively. Provide an accurate PCR program that will amplify the sequence based on the primers you designed. Provide the amino acid sequence of the protein encoded by the gene. Provide details of the theoretical molecular weight and isoelectric point of the protein. Use your bioinformatics skills to provide details of the TM regions of the proteins. Name the protein and provide a brief description of its role in health and disease. Remember to label figures appropriately and provide figure legends. > Gene_X CGCGCGCTGCCTGAGGACGCCGCGGCCCCCGCCCCCGCCATGGGCGCCCCTG CCTGCGCCCTCGCGCTCTGCGTGGCCGTGGCCATCGTGGCCGGCGCCTCCTCG GAGTCCTTGGGGACGGAGCAGCGCGTCGTGGGGCGAGCGGCAGAAGTCCCG GGCCCAGAGCCCGGCCAGCAGGAGCAGTTGGTCTTCGGCAGCGGGGATGCTG TGGAGCTGAGCTGTCCCCCGCCCGGGGGTGGTCCCATGGGGCCCACTGTCTG GGTCAAGGATGGCACAGGGCTGGTGCCCTCGGAGCGTGTCCTGGTGGGGCCC CAGCGGCTGCAGGTGCTGAATGCCTCCCACGAGGACTCCGGGGCCTACAGCT