Question
Introduction to Biotechnology 2024 LAB 5 Worksheet DNA is a long polymer of four distinct nucleotides, which exists as a double stranded helical molecule. The four nucleotides are abbreviated as A, C, G, T. Their sequence in double-stranded DNA varies as it goes along. Occasionally, and purely by chance, there occurs in the DNA what are called palindromic sequences of nucleotides. These are symmetrical sequences, which read the same forward as they do backward on the opposite strand of DNA. Two examples of these palindromic sequences are highlighted in the sequence below. TTAGAAGCTTTTATCCGTAAAAGAATTCCTTTCAGAAACGCGGAT..etc AATCTTCGAAAATAGGCATTTTCTTAAGGAAAGTCTTTGCGCCTA..etc In bacteria, palindromic sequences are recognized by specific enzymes whose purpose in nature is usually to destroy DNA. These enzymes are called endonucleases. Each restriction enzyme has a highly specific shape, so it can only stick to certain sequences of letters in the DNA code. This is called a "recognition sequence” or "restriction site”. If its "recognition sequence" is present, the enzyme will be able to Bind to the recognition sequence on each of the DNA strands and cut the DNA in a very specific way. For example, when EcoRI recognizes and cuts this site, it always does so in a very specific pattern that produces ends with single-stranded DNA “overhangs” (Figure 1): AATTC 5' 3' GAATTC CTTAAG 3' 5' S' 3' G G CTTAA EcoRI enzyme Figure 1 EcoRI restriction pattern Page 1 of 5 mis 3' 5' Introduction to Biotechnology 2024 Exercise 1: (a) Study the DNA sequence below carefully. It's a length of linear double-stranded DNA (both strands are shown). Find and indicate on the sequence where the restriction endonuclease EcoRI will cut the DNA (i.e. search the DNA for the palindromic sequence required for recognition by the enzyme EcoRI). The hyphen means that the DNA continues onto the next line. TTAGAAGCTTTTATCCGTAATAAGGAATTCCTTTCAGAAACGCGGATACCCCCGTA- AATCTTCGAAAATAGGCATTATTCCTTAAGGAAAGTCTTTGCGCCTATGGGGGCAT- TTATCCGTAAATGGATTTCAGAAACGCGGATACCAATTCCGAGAAATAAAGGCCCG- AATAGGCATTTACCTAAAGTCTTTGCGCCTATGGTTAAGGCTCTTTATTTCCGGGC- ATACTTATCCGTATAAAGGATTCCAGAACGCGGATACCAATTCCGAATTCATAAAG- TATGAATAGGCATATTTCCTAAGGTCTTGCGCCTATGGTTAAGGCTTAAGTATTTC- TATTAGGCTGCTAGCTAGCGCTAGATCGCAGTCGTAGCTAGTCGTAGCGCGCGTAT- ATAATCCGACGATCGATCGCGATCTAGCGTCAGCATCGATCAGCATCGCGCGCATA- ACGCGGATACCAATTCCGAATTCATAAAGAGTCGTAGCTAGTCGTAGCGCGCGAAA TGCGCCTATGGTTAAGGCTTAAGTATTTCTCAGCATCGATCAGCATCGCGCGCTTT (b) How many times does the EcoRI site occur in the sequence above? (c) If the DNA sequence above was treated with EcoRI, how many fragments of DNA will result? (d) How long will each resulting fragment of DNA be after cutting with EcoRI? Count the bases pairs in each. (Note: a base pair is two bases bonded to one another) Page 2 of 5 Introduction to Biotechnology 2024 (e) Indicate in the gel below the pattern of DNA fragments which you would see after the digest was run on an electrophoresis gel. Indicate the size (bp) of each of the fragments Direction of electrophoresis Exercise 2: The restriction enzymes EcoRI, HindIII and BamHI were used to cut lambda DNA. The restriction site for each enzyme is shown here, indicated by the arrow. EcoRI 5....GAATTC.....3' 3.....CTTAA G......5 1 ↓ HindIII 5.A AGCTT....3° 3....TTCGA A...5' ↑ BamHI 5...G GATCC.....3° 3.....CCTAG G.....5 Page 3 of 5 Introduction to Biotechnology 2024 21226 7421 23130 9416 6557 bp 16841 4361" 7233 3383 6770 6627 6626,5506 ||| 0.7% agarose 5804 5643 4878 3530 1.0% agarose 564 125 1% agarose EcoRI HindIII BamHI Figure 2 Expected restriction patterns of lambda DNA cut with various restriction enzymes Figure 2 above shows the size of each of the fragments/bands produced when lambda DNA is cut with each of these restriction enzymes. The sizes were determined by comparison to a molecular ladder. Figure 3 below represents complete lambda DNA sequence and indicates the total number of base pairs (bp) it contains (48502 bp). Samples labelled A, B and C represent lambda DNA cut with one of the three restriction enzymes (EcoRI, HindIII and BamHI) where the lines indicate the DNA being cut by the enzyme. Use these diagrams to answer the following questions. ADNA 0 10,000 20,000 30,000 40,000 48,502 (bp) A 5505 22,346 27,972 34,499 41,732 (bp) 1 B 21,226 26,104 31,747 39,168 44,972 (bp) C 23,130 27,479 36,895 37,584 44,141 25,157 37,459 (bp) Figure 3 Complete lambda DNA sequence (48,502 bp) and lambda DNA cut with 3 different restrictions enzymes (A, B, C). Page 4 of 5 Introduction to Biotechnology 2024 (a) Calculate the size the resulting fragments will be after digestion by each enzyme A, B and C and complete the table below. lambda DNA cut with enzyme A List fragment sizes in decreasing order of size lambda DNA cut with enzyme B lambda DNA cut with enzyme C List fragment sizes in decreasing order of size List fragment sizes in decreasing order of size (b) How many fragments would you expect to see for each of the DNA sequences cut with an enzyme A, B and C on the agarose gel? (c) Compare the size of the fragments that you have calculated with the bands shown in the Figure 2 and determine which of the enzymes (BamHI, EcoRI and HindIII) are A, B and C. (d) How many times does the sequence GAATTC occur in the lambda DNA sequence? What about AAGCTT and GGATCC? Page 5 of 5