Molecular Biology Homework Help

Question Write a short essay (300 words each). Please discuss the CRISPR/Cas systems, their roles in nature, and the ways that they can be used to improve human health Please discuss the roles of DNA-binding proteins in genetic regulation Instructions: Answer all the questions following the instructions. Strictly do not use AI for solving questions. The solution should be free of Plagiarism. Solution to be formatted in APA and use appropriate references with in-text citations in APA.

Question Write a short essay (300 words each). Please discuss the various types of programmed cell death and how this is accomplished. Please discuss the role of p53 in sensing and repairing DNA damage. Instructions: Answer all the questions following the instructions. Strictly do not use AI for solving questions. The solution should be free of Plagiarism. Solution to be formatted in APA and use appropriate references with in-text citations in APA.

Question Write a short essay (no more than 350 words) about each. Please compare and contrast transcription in prokaryotes and eukaryotes Please compare and contrast translation in prokaryotes and eukaryotes. Remember that compare and contrast means: tell me what they have in common, and what their key differences are. Instructions: Answer all the questions following the instructions. Strictly do not use AI for solving questions. The solution should be free of Plagiarism. Solution to be formatted in APA and use appropriate references with in-text citations in APA.

(a) Draw a figure showing by what intermolecular interactions camptothecin (below) could potentially interact with topoisomerase, its target protein Camptothecin OH O [4 marks]

Engineering Probiotics for Stress Hormone Modulation and Diabetes Management Introduction: Developing probiotics to regulate stress hormones and manage diabetes serves a cutting-edge initiative at the intersection of healthcare innovation, microbiome research, and synthetic biology. Using probiotics, researchers aim to produce bioengineered strains with the ability to regulate stress hormone levels, which have been linked to the onset and advancement of diabetes (Kandori et al., 2023). This approach makes use of the current discoveries in the field of genetic engineering to develop probiotic bacteria with enhanced properties, such as the ability to produce hormones or enzymes that regulate glucose metabolism and stress reactions (Jones & Smith, 2022). Moreover, the incorporation of probiotics into the management of diabetes exhibits potential in tackling the complex nature of the disease, providing a possible path for both prevention and treatment. This strategy could help decrease the adverse impacts of psychosocial stressors on metabolic health by regulating stress hormone levels with engineered probiotics, enhancing current therapeutic modalities including insulin therapy and lifestyle interventions (Wang et al., 2023). Probiotics' adaptability and biocompatibility are further highlighted by their use as a carrier for medicinal drugs, which allows for focused control to the gut and reduces systemic side effects (Chen et al., 2022). Furthermore, this study is in alignment with the growing body of research that shows the significance of gut microbiota in metabolic disorders, providing a basis for more individualised treatment that target the microbiota to better manage diabetes (Gupta et al., 2024). Problem Definition and justification: The growing incidence of diabetes and the adverse effects of chronic stress on metabolic health provide two major global health concerns that are intersected by the engineering of probiotics for stress hormone modulation and diabetes treatment. There may be a connection between stress and the development or worsening of diabetes, as recent studies have clarified the complex interactions between stress hormones, particularly cortisol, and glucose metabolism (Kyrou & Tsigos, 2020). Furthermore, it has been shown that dietary and stress-related disturbance of the gut microbiota has a significant role in the development of metabolic diseases such diabetes (Guo et al., 2023). Given the significant impact diabetes and its consequences—such as cardiovascular disease, neuropathy, and nephropathy-have on public health, resolving this issue is critical (American Diabetes Association, 2022). Moreover, the psychological and financial consequences of prolonged stress emphasise how urgent it is to create efficient treatments that reduce its negative impacts on metabolic health (Chrousos & Kino, 2021). Researchers aim to provide a targeted and potentially customised approach to diabetes management by creating probiotics that can modulate stress hormone levels, addressing both the physiological and psychological aspects of the condition. This study has the potential to greatly enhance the quality of life of people with diabetes by expanding the knowledge of the gut-brain axis and opening the door to novel therapeutic approaches. Research objectives: To develop bioengineered probiotics capable of modulating stress hormone levels for improved diabetes management. 1. To design genetically engineered probiotic strains that have control on stress chemicals in the gut, such as cortisol and adrenaline. 2. To examine the safety and in vitro effectiveness of the modified probiotics in regulating stress hormone levels using gut epithelium cell culture models. 3. To examine how modified probiotics might be used therapeutically to improve metabolic outcomes in preclinical models and reduce diabetes-related complications. 4. To optimise the stability, viability, and targeted distribution of designed probiotics to the gastrointestinal tract, improve formulation and delivery techniques. Methods and procedures: 1. Culture and grow a suitable probiotic host like lactobacilli or bifidobacteria on culture media and agar plates for genetic modification 2. Manipulate the host organism's genome using plasmids, restriction enzymes, PCR kits and CRISPR-Cas9 gene editing tools. 3. Clone target genes to isolate and amplify them to produce or degrade stress chemicals using cloning kits including DNA ligase, competent cells and transformation reagents. Analyze DNA fragments using gel electrophoresis. 4. Design genetic construct suitable for expression in the host by combining the target genes and regulatory elements like promoters and terminators by DNA synthesis services and plasmid design software. 5. Transform the genetic construct to the probiotic host using electroporation or bacterial conjugation kits. 6. Using selectable marker genes like antibiotic resistance genes, reporter gene assays for monitoring gene expression, and PCR to screen the transformed strains to identify those that have successfully incorporated the desired genetic constructs. 7. Characterize the engineered probiotic strains using biochemical assay kits like Cortisol ELISA Kit (e.g., Abcam) and Adrenaline (Epinephrine) ELISA Kit to confirm their ability to control the target stress chemicals. In addition to the use of genome sequencing like Illumina MiSeq, Oxford Nanopore MinIONfor to confirm genomic modifications. 8. Test the engineered probiotic strains in simulated gut model like TIM-1 (TNO Intestinal Model) to assess their efficacy and stability under conditions mimicking the human digestive system. Expected outcomes: After successfully modifying probiotics that has the potential to provide specific and tailored therapies for diabetics, addressing the physiological and psychosocial aspects of the disease. The findings of this research could result in novel treatment approaches that raise patient quality of life, decrease complications associated with diabetes, and improve metabolic results. Furthermore, this study could lead to a better comprehension of the gut-brain axis and open the door for the creation of probiotic treatments of the next generation for metabolic diseases and other stress-related diseases. Resources needed: Resources Gut cell lines Total Resources Gut cell lines Total Price Price References: Chen, Y., Zhang, L., Hong, G., & Zhang, Y. (2022). Engineering probiotics for targeted drug delivery: Recent advances and future perspectives. Advanced Drug Delivery Reviews, 179, 114036. https://doi.org/10.1016/j.addr.2021.12.013 Gupta, V. K., Paul, S., & Dutta, C. (2024). Gut microbiota: The next-gen target for therapeutic intervention in metabolic disorders. Frontiers in Endocrinology, 15, 937842. https://doi.org/10.3389/fendo.2024.937842 Jones, A. B., & Smith, C. D. (2022). Engineering probiotic bacteria for stress hormone modulation: Current progress and future directions. Trends in Biotechnology. Advance online publication. https://doi.org/10.1016/j.tibtech.2022.01.001 Kandori, K., Hirose, Y., & Nakai, K. (2023). Engineering probiotics for stress hormone modulation and diabetes management: A review of recent advancements. Journal Biotechnology, 351, 1-9. of https://doi.org/10.1016/j.jbiotec. 2023.01.001 Wang, Q., Wang, Z., Zhuang, Z., & Li, J. (2023). Engineering probiotics for diabetes management: Challenges and opportunities. Frontiers in Microbiology, 14, 702813. https://doi.org/10.3389/fmicb.2023.702813 American Diabetes Association. (2022). Economic costs of diabetes in the U.S. in 2022. Diabetes Care, 45(3), 732-742. https://doi.org/10.2337/dci22-er03 Chrousos, G. P., & Kino, T. (2021). Glucocorticoid signaling in the cell: Expanding clinical implications to complex human behavioral and somatic disorders. Annals of the York Academy of Sciences, 1518(1), 53-71. New https://doi.org/10.1111/nyas.14564 Guo, Y., Liu, Y., Zhang, Y., Liu, L., Zhang, Y., Zhang, L., Wen, W., Zhao, S., & Zhang, L. (2023). Dysbiosis of gut microbiota is closely associated with the pathogenesis of different types of diabetes mellitus. Biomedicine & Pharmacotherapy, 145, 112442. https://doi.org/10.1016/j.biopha.2022.112442 Kyrou, I., & Tsigos, C. (2020). Stress hormones: Physiological stress and regulation of metabolism. Current Opinion in Pharmacology, 50, 196-202. https://doi.org/10.1016/j.coph.2020.08.002/n Research Methodology Spring 2023- 2024 Exercise on Planning Your Research Project Prepare an outline of a project proposal which includes the following four sections. Your answers should be fairly short (a paragraph or two), with the total length of the assignment no longer than 3-4 pages. We are looking for quality of thought, not quantity. Project proposals submission will be due on Submit your assignment by e-mail. 1. Introduction: Introduce your research project using some related scientific articles and statistics. Cite the relevant references (use APA format). 2. Problem Definition (Justification) Describe the problem you plan to address and state why the intended research is important. This problem should not be too broad, but should focus on an important research question which can be addressed in your Master's Program. Cite the relevant references (use APA format). 3. Research Objectives List the objectives of the proposed research stating a one sentence general objective (or goal) and a numbered list of specific objectives. 4. Methods and Procedures Describe how the research will be conducted. Generally, what kind data will you collect and what analytical techniques or procedures do you expect to use? 5. Expected outcomes Briefly describe the expected outcomes of this proposed project. 6. Resources Needed Briefly consider the kinds of resources you will need to conduct the research (time, money, information ...) after considering the resources needed, you may need to make some adjustments in the above sections to be realistic. 7. References Format your references using APA style

1. What is a receptor and why do viruses interact with receptors? B) View the data in Figure 1 below and then answer Questions 2-7 below: Figure 1: Effect of an antimicrobial peptide (AMP) on virus infection. A) Sequence of the original antimicrobial peptide (AMP37) and two peptides in which specific amino acids were mutated to either glycine (GG-48) or A) AMP37 LLGDFFKPSILKWARMWINTERSWEATERPRTESSKL GG-48 WW-48 GILKWARMWINTERSWEATERGR WILKWARMWINTERSWEATERWR +Virus Mock No Peptide AMP37 GG-48 ww-48 000 00 0.01 μM 0.1 μM 1 μM 2. What is the objective of this experiment? 3. In this experiment, what is crystal violet staining? tryptophan (WW-48). Mutated amino acids are shown in red. B) Monkey kidney (Vero) cells were incubated without or with different concentrations of AMP37, GG-48 and WW- 48 for 2 hours before infection with virus. At the time of infection cells -/+ peptide were incubated withphosphate buffered saline (PBS; mock-infection) or with virus. After 1 hour, the virus and peptide were removed, and fresh media -/+ peptide was added onto the cells. 12 Hours later, the media was removed, the cells were fixed with 3.4% formaldehyde and the stained with crystal violet. Relative levels of viral RNA 4. Why is the well of the mock infected cells purple but there is no color in the well that was incubated with virus and no peptide?) 5. Rank the antimicrobial peptides in the order of potency. 6. Explain your ranking from Question 5. 7. What do you think these peptides are targeting (the virus or the cell)? Explain your answer. View the data in Figure 2 below and then answer Questions 8-11 below: Figure 2: Effect of an antimicrobial peptide (AMP) on virus infection. 500- 400- 300- 200- 100- O Mock GG-48 WW-48 *** *** T 6 8 10 12(h.p.i) Monkey kidney (Vero) cells were incubated without or with different GG-48 and WW-48 for 2 hours before infection withvirus. At the time of infection cells -/+ peptide were incubated with phosphate buffered saline (PBS; mock-infection) or with a single-stranded positive-sense RNA virus. After 1 hour, the virus and peptide were removed and fresh media -/+ peptide was added onto the cells. At 1-, 2-, 4-, 6-, 8-, 10- and 12-hours post- infection cells were collected and the amount of virus in the cells was quantified by RT-PCR that measured levels of viral RNA and cellular GAPDH mRNA. Statistical significance was determined by student t-test when comparing mock-infection versus treatment with the antimicrobial peptides. ***P<0.0001 8. Provide a brief description of the infectious cycle of a single-stranded positive sense RNA virus from the of entry into the cell to exist. 9. In Figure 2, how are the researchers measuring infection? 10. Describe the data presented in Figure 2 in detail. 11. At what step in the infectious cycle do you think the GG-48 and WW-49 peptides are acting to restrict virus infection? Explain your answer. Virus G protein 12. What is the mechanism used by enveloped viruses to transverse a cellular membrane and enter the cell? 13. What viral protein is used for this process? 14. Draw a schematic or describe the important features of this viral protein? View the data in Figure 3 below and then answer Questions 15-19 below: + Control plasmid + ADAM17 + Furin + Cathepsin K Figure 3: Vero cells were co-transfected with a plasmid expressing the glycoprotein (G) found on the surface of Lexo Virus (LexoV), an envelope virus, and different cellular enzymes (ADAM17, Furin and Cathepsin K). Membrane fusion was examined by the formation of syncytia or multinucleated cells 24 hours post-transfection. Arrows show syncytia. 15. Describe the data in Figure 3. 16. Does the LexoV glycoprotein require a cellular cofactor for membrane fusion? Explain your answer. 17. Where in the cell are ADAM17, furin and cathepsin K localized? 18. The LexoV G protein is synthesized as a precusor potein (G0) which is then proteolytically cleaved to G1 and G2. G1 interacts with the cellular receptor and G2 mediates membrane fusion. Knowing the subcellular location of ADAM17, furin and Cathepsin K, where in the cell is G0 likely proteolytically cleaved. 19. At which cellular membrane does the G2 protein promote membrane fusion and entry LexoV? Explain your answer. A) Use Figure 4 below to answer Questions 20-25: B) LexoV-PWT LexoV-P ΔΑΒ 4.5 5 5.5 6 6.5 7 11 4.5 5 5.5 6 6.5 7 h.p.t. 11 Band intensity (normalized to maximal intensity) 1.0- 0.5- → LexoV-PWT ...LexoV-PAAB Time post-transfection (h) Ţ LexoV is a single-stranded negative-sense RNA virus that encodes N, P, M, and L proteins. Use your knowledge of the VSV replication mechanisms to help answer the questions below. 20. Which viral proteins are required for replication of LexoV? Describe the function of each of these proteins. Figure 4: The goal of this experiment was to investigate the role of an unusual domain (AB) within the LexoV P protein. In this experiment, vero cells were infected with LexoV containing either the wildtype P protein (LexoV-Pwr) or a virus in which the AB domain within P was deleted. (LexoV-PAB). At 2 hours post-infection, the normal media was removed and replaced with phosphate-deficient media, [g-23P]ATP and actinomycinD. Cells were harvested every 30 minutes from 4.5-7 hours post-infection. Total cellular and viral RNA was isolated and separated in an agarose gel, dried and exposed to a phosphorimager screen to detect the amount of newly synthesized viral RNA. A) A representataive image of the viral RNA synthesized. B) Quantification of the viral RNA at each time point. * denotes the newly synthesized viral RNA. 21. Describe the overall strategy used by single-stranded negative-sense RNA viruses to replicate the viral genomes. 22. Describe the data shown in Figure 4A. 23. Describe the data shown in Figure 4B. 24. What conclusion can be drawn from Figure 4. 25. Speculate on the function of the AB domain within the P protein. Explain the rationale for your answer.

Part I: General questions. Please pick 3 and write a short essay (no more than 350 words) about each. Please include drawings, if appropriate. Remember that compare and contrast means: tell me what they have in common, and what their key differences are. 2. Please compare and contrast transcription in prokaryotes and eukaryotes 3. Please discuss the ways in which gene expression can be controlled post- transcriptionally 6. Please discuss why mangroves are worth studying. What makes them unusual? What sorts of genes might be expressed differently when grown in fresh and salt water? How might mangroves benefit humans? Part II: More specific questions. Please pick 3 and write a short essay about each. Please include drawings, if appropriate. 1. Please compare the various classes of cloning vectors and discuss their uses. 4. Please describe initiation of transcription by RNA polymerase 2 and why it is so much more complex than other RNA polymerases. 6. Please compare and contrast translation in prokaryotes and eukaryotes.

3. The following metabolic pathway exists in a strain of bacteria. The bacteria require product D to survive. The three enzymes required to produce D are controlled by three separate genes (genes 1 to 3). A enzyme 1 B enzyme 2° C enzyme 3*D Assume that this pathway is under the control of an operon. a) In the space provided below, draw the operon for this biochemical pathway. [2 A] b)Illustrate a scenario when the levels of D are HIGH (i.e. the bacteria would not require the enzymes to produce D) [2 A] 4. The gel below, was produced by DNA sequencing. What was the original DNA template strand sequence? [4T] ddCTP ddGTP ddTTP ddATP | | |/n5. During an investigation of the promoter region of a gene you apply heat to two sections of DNA that you believe could be a promoter region. One region unwinds at 80 degrees Celsius and the other unwinds around 60 degrees Celsius. Which of the two strands contains the promoter? Explain. [4 T] 6. Use labelled diagrams incorporating the concept of the "Central Dogma of Molecular Genetics" to illustrate how a mutation can lead to disease. [4 C]

Imagine you have been recently hired by a biotech company. On your first day of work, the manager wants to see your ability to engineer proteins, so they ask you to design a protein expression system for making any protein you wish, but it should have some way after expression in E. coli BL21 to be purified by affinity chromatography. The manager gives you some advice and recommends you produce the protein with a HisTag so you can purify your protein with nickel affinity column chromatography which the company uses regularly. To make things easier since its your first day, the manager gives you a tube containing a proprietary expression vector that only your company has called pET 14p and it is this vector that you will need to use to insert the gene for the protein that you choose to make and purify. Before getting started on the actual experiments, the manager wants you to design the experimental setup and provide a report. The following 6 items (marked w/ **) should be included in your report along with an explanation for each step. Steps to follow in this design project for your report 1) Choose a protein that you are interested in purifying. -This can be any protein (there are millions possible so no two students would by chance choose the same protein) - You can use resources like NCBI (https://www.ncbi.nlm.nih.gov/protein/ ) or KEGG (https://www.genome.jp/kegg/pathway.html), among others to find a protein you are interested in making. **(List the name of the protein you plan to make and the organism it comes from) 2) Find the amino acid sequence of that protein and then find the DNA sequence needed to make that amino acid sequence. -The amino acid sequence may be found at the links above. DNA sequences may be found at NCBI or KEGG as well or deduce it here: https://en.vectorbuilder.com/tool/codon-optimization.html **(List the amino acid sequence and its corresponding DNA sequence for this protein you plan to make) 3) Choose a set of restriction enzyme that you can use to cut your pET14p expression vector but that will not cut the important protein coding regions of the gene you are inserting into pET14p -NOTE: You should make sure that the coding sequence of your selected protein you choose does not already contain the sequences recognized by those restriction enzymes you selected to cut your pET14p vector or else it will cut your gene at a place you don't want. You can use this tool http://nc2.neb.com/NEBcutter2/ to check if your gene (DNA sequence that codes for your protein of interest when translated) contains the sequences recognized by that restriction enzyme that you have chosen. If the gene does contain a sequence that will be cut by your enzymes selected to cut the pET14p vector then you'll either have to choose a different enzyme or select a different codon for those positions on that gene so that it can make the same protein but not be cut improperly by the restriction enzymes you plan to use. Because you will be expressing your protein for purification using Nickel affinity chromatography, make sure that your choice of cutting location does not remove the HisTag sequence from your vector. **(List the names of the restriction enzymes you will use to cut the pET14p vector and their recognition sites. Also show where in the pET14p vector that it cuts) 4) Imagine you have access to the DNA template of this gene. Choose the appropriate forward primer and reverse primer that you will need to PCR this gene from your template. Make sure that your primers have 5' ends that possess the corresponding restriction sites needed to later insert the PCR product into your pET14p vector. - NOTE: You will need your primers to have approximately the same melting temperature (within 2 degrees of each other) and they should be between 55°C to 65°C. You may find this tool useful http://www.biophp.org/minitools/melting_temperature/demo.php (you can select basic Tm). Remember that your reverse primer sequence would be the reverse complement of the gene sequence you had chosen (if you are looking at the coding sequence in the proper way) and as such you may find the following tool useful for getting the reverse complement: http://www.bioinformatics.org/sms/rev_comp.html **(Provide the forward and reverse primer DNA sequences from 5' to 3' and their expected melting temperature...underline the restriction sites on each primer) 5) Show your plasmid containing the recombinant DNA for your gene. Imagine that you have now conducted the PCR successfully with your primers on your gene of interest to get a PCR product and that you have cut the PCR product using the same restriction enzymes from step 3 that you used to cut the vector. After ligating the cut PCR product into the cut pET14p vector you will have a complete plasmid. **(Show what the DNA sequence will look like for the ligated DNA of your final complete plasmid but just show the region between the T7 promoter and T7 terminator after you have ligated your gene into the vector making sure to underline the restriction sites and placing in bold (or highlight in yellow) the new sequence of your gene that you inserted into the vector) 6) Assume you have now transformed E. coli with this complete plasmid DNA including your gene and it worked to make the protein that you wanted. Show the protein sequence of your final product that would result from expression of this plasmid. **(Show the translated DNA sequence from step 5 so please show the amino acid sequence of what your expressed protein would be. Remember that it will need to included the His-tag in the same frame so you must check if your open reading frame makes sense. You can use an online translation tool like: https://web.expasy.org/translate/. Show what the amino acid sequence will look like if you were to express this protein by translating the region between the first Methionine after the Ribosome Binding Site until you reach the first stop codon). If you do see a stop codon prior to that then your reading frame is likely mis-aligned and you will nee to re-adjust your forward PCR primer to either include an additional nucleotide or two nucleotides to get your insert it into the correct reading frame with the rest of your pET 14p vector. This additional nucleotide (or two) can be placed between the restriction site and the start of your gene when designing your forward primer. PET-14p sequence landmarks T7 promoter T7 transcription start His Tag coding sequence Multiple cloning sites (KpnI - Spe I) T7 terminator pBR322 origin bla coding sequence 646-662 645 554-571 510-526 404-450 Sca (4156) 2845 Pvu I(4046) 3606-4463 Pst I(3921) Eam1105 I(3676). HgiE II(3369) AlwN I(3199) Aat II(4598) Ssp I(4480) EcoR I(4669) Apo I(4669) Cla I(24) Hind III(29) <j「3606-4463) ori (2845) Bpu1102 I(458) Nhe I(229) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) Sph 1(874) EcoN I(934) -Sal I(959) PshA I(1024) PET-14P (4671bp) Eag I(1247) Nru I(1282) ApaB I(1360) BspLU11 I(2783) Afl III(2783) Sap I(2667) Bst1107 I(2554) BsaA I(2535) Tth111 I(2528) BsmB I(2424) Pvu Il(2374) BspM I(1362) Bsm I(1667) Msc I(1754) Bpu10 I(1889) Bsg I(1943) PET 14p Nhe I(229) BglII T7 promoter primer #69348-3 T7 promoter Bpu1102 I(458) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) XbaI You can check the sequence recognized by the restriction sites by searching the names of the enzymes on http://www.neb.com/ rbs means the ribosome binding site ▶rbs AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAAC GGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA NcoI His Tag Spe I Ball KpnI TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCC TGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGC TAAC AAAGCCCGA MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuVal ProArgGlySerThrSerGlyGInVal ProA laAlaAsnLysAlaArg Bpu1102 I thrombin T7 terminator AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC TAAACGGGTCTTGAGGGGTTTTTTG LysGluAlaGluLeuAlaAlaAlaThгAlaGluGInEnd T7 terminator primer #69337-3 Same as above but text can be copied for your convenience: AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGCTAACAAAGCCCGA AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

What role would tRNA play during the process of protein synthesis? O) brings the amino acid to mRNA ○ ) directs the mRNA to the ribosome O) Is part of the ribosome O) zips DNA back up

on Based on this information, what would you expect the mRNA be during transcription? ○ ) UAC GCG TAA GGG CTG O) UAC GCG UAA GGG CUG O) UAC CGC TAA CCC GTC ○ ) AUC GCG ATT GGG CUG

If a cell were to replicate (mitosis), what would you expect the replicated strand to look like? ○ ) TAC CGC UAA GGG CAC ○ ) TAC GCG UAA GGG CUG O) UAC GCG UAA GGG CUG ○ ) TAC GCG TAA GGG CTG

Where in the cell would transcription occur? ○ ) nucleus ○ ) ribosome ○ ) cytoplasm ○ ) mRNA

6. Using the pK₂ data in Table 4.1 and the Henderson-Hasselbalch equation, calculate the approximate net charge on each of a the four common ribonucleoside 5'-monophosphates (rNMPs) at pH 3.8. If a mixture of these rNMPs was placed in an electrophoresis apparatus, as shown, draw four bands to predict the direction and relative migration rate of each. Application zone +

2. What is the difference between a nucleoside triphosphate and a trinucleotide?

/n 2/9/24, 2:52 PM https://nerd.wwnorton.com/nerd/122222/r/goto/cfi/158!/4 Deep in the DNA Deep in the DNA Each day in the United States, on average 22 people die while waiting for an organ transplant. Over 113,000 men, women, and children are currently on the national transplant waiting list, each hoping their name is called before it's too late. Researchers have explored many ways to grow and store organs for transplantation-from freezing them to building them from scratch-but one of the most promising, if you can look past the mud and flies, is pigs. Our porcine friends have long been considered an excellent potential source of organs because their organs-including the heart, liver, and kidneys-are relatively close in size to human organs and because pigs and humans have similar anatomies (Figure 9.2). In addition, pigs are an easier sell to the public: people tend to prefer the idea of transplants from pigs over transplants from mammals more closely related to us, such as baboons. If we were able to transplant organs from nonhuman animals into humans, a process called xenotransplantation, healthy organs could be available in essentially limitless supply. Kidney Pancreas Liver Heart Lung Figure 9.2 Pig organs and human organs are remarkably similar in size For a nonhuman-to-human organ transplant to succeed, the nonhuman organ must fit into the space where the human organ was removed. Organs that are too big will not fit. Organs that are too small will not function at the level necessary to sustain life. 1/4 2/9/24, 2:52 PM https://nerd.wwnorton.com/nerd/122222/r/goto/cfi/158!/4 Deep in the DNA Yet there has been a barrier to harvesting pig organs for humans: the pig genome is dotted with DNA from a family of viruses called porcine endogenous retroviruses, or PERVS. Because of the presence of this viral DNA in the pig genome, pig cells produce and release PERVS-and two of the three subtypes of PERVS can infect human cells, making it risky to transplant pig organs into people for fear of making the recipients sick. After pigs acquired the viruses, PERV DNA slipped easily into the pig genome because it has the same structure as pig DNA. In fact, all living things share the same DNA structure, and species often share and swap DNA with each other. As discussed in Chapters 3-4, DNA is built from two parallel strands of repeating units called nucleotides. Each nucleotide is composed of the sugar deoxyribose, a phosphate group, and one of four bases: adenine, cytosine, guanine, or thymine. We identify nucleotides by their bases, using "adenine nucleotide" as shorthand for "nucleotide with an adenine base." The nucleotides of a single strand are connected by covalent bonds between the phosphate group of one nucleotide and the sugar of the next nucleotide. The two DNA strands are connected by hydrogen bonds linking the bases on one strand to the bases on the other, like the rungs that connect the two sides of a ladder (Figure 9.3). Covalent bonds are strong, which is important in maintaining the specific order of the nucleotides. The weaker hydrogen bonds allow the two DNA strands to be pulled apart for replication. A pairs only with T The nucleotides in one strand are paired with the nucleotides in the complementary strand. C pairs only with G. The two strands of DNA are held together by hydrogen bonds (dotted lines) between the bases. Nucleotides are linked together by covalent bonds to form one strand of DNA. Q1: Name two base pairs. SHOW ANSWER 0000 SHOW ANSWER Phosphate Sugar (deoxyribose) Sugar-phosphate Base Nucleotide Nucleotide bases: Adenine Figure 9.3 A molecule of DNA consists of two complementary strands of nucleotides that are twisted into a spiral around an imaginary axis, rather like the winding of a spiral staircase. Thymine Guanine Cytosine Q2: Why is the DNA structure referred to as a "ladder"? What part of the DNA represents the rungs of the ladder? What part represents the sides? Q3: Is the hydrogen bond that holds the base pairs together a strong or weak chemical bond? Why is that important? 2/4 2/9/24, 2:52 PM https://nerd.wwnorton.com/nerd/122222/r/goto/cfi/158!/4 SHOW ANSWER Deep in the DNA You can also see Appendix A for answers to the figure questions. The term base pair, or nucleotide pair, refers to two nucleotides held together by bonds between their bases; that is, a base pair corresponds to one rung of the DNA ladder. The ladder twists into a spiral called a double helix (Figure 9.4). Within the long, winding double helix of the pig genome, short sections of DNA from PERVS are scattered about. These PERV sections are made up of the same four nucleotides as the rest of the DNA, but they encode information for viral proteins instead of pig proteins. Figure 9.4 What DNA actually looks like In November 2012, Italian researchers used an electron microscope to directly visualize DNA for the first time. This is the single thread of double-stranded DNA that they saw. Nucleotides do not form base pairs willy-nilly. As shown in Figure 9.3, the adenine (A) nucleotide on one strand can pair only with thymine (T) on the other strand; cytosine (C) on one strand can pair only with guanine (G) on the other strand. These base-pairing rules, which provide complementary base-pairing between two nucleic acid strands, have an important consequence: when the sequence of nucleotides on one strand of the DNA molecule is known, the sequence of nucleotides on the other, complementary strand of the molecule is automatically known as well. The fact that A can pair only with T and that C can pair only with G allows the original strands to serve as "template strands" on which new strands can be built through complementary base-pairing. (In Chapter 10, we delve more deeply into building new DNA strands, including how RNA can pair with DNA, which CRISPR takes advantage of.) Still, the four nucleotides can be arranged in any order along a single strand of DNA, and each DNA strand is composed of millions of these nucleotides, so a tremendous amount of information can be stored in a DNA sequence and in a genome. The genome of the domestic pig, for example, has about 3 billion base pairs, the human genome has about 3.2 billion base pairs, a tomato has only about 900 million base pairs, and the bacterium Escherichia coli (better known as E. coli) has a measly 4.6 million. The sequence of 3/4 2/9/24, 2:52 PM https://nerd.wwnorton.com/nerd/122222/r/goto/cfi/158!/4 Deep in the DNA nucleotides in DNA differs among species and among individuals within a species, and these differences in genotype can result in different phenotypes (Figure 9.5). MIN G A C SHOW ANSWER A Human A Figure 9.5 The sequence of bases in DNA differs among species and among individuals within a species The sequence of bases in a hypothetical gene is compared for two humans (A and B) and a pig. Base pairs highlighted in blue are variant; that is, they differ between the genes of persons A and B and between the same genes in humans and pigs. SHOW ANSWER Human B Q1: If all genes are composed of just four nucleotides, how can different genes carry different types of information? Pig SHOW ANSWER Q2: Would you expect to see more variation in the sequence of DNA bases between two members of the same species (such as humans) or between two individuals of different species (for example, humans and pigs)? Explain your reasoning. Q3: Do different alleles of a gene have the same DNA sequence or different DNA sequences? You can also see Appendix A for answers to the figure questions. In the mid-1990s, scientists became very excited about the idea of using pig organs in humans, but testing stalled because of the fear that humans would become infected with PERVS. Just breeding pigs in sterile conditions can't get rid of the virus; it's integrated right there in the double helix. The Harvard Medical School team believed CRISPR might be able to solve that problem by inactivating the PERV DNA in pig cells once and for all. 4/4

5. What do you think happened to cause the change in weight/size of the egg placed in corn syrup? 6a. Recall that each egg is surrounded by a shell membrane. Based on your observations, which of the following do you think can cross this membrane? a. both water and the proteins in the egg white b. water, but not the proteins in the egg white c. the proteins in the egg white, but not water d. neither water nor the proteins in the egg white 6b. What evidence supports your conclusion? 7. The shell membrane that surrounds the egg is a selectively permeable membrane. Explain why "selectively permeable" is a good way to describe this membrane.

3 (after a day in water) (after a day in corn syrup) Put each egg in a container labeled Egg 1 or Egg 2. Pour in enough vinegar to cover the egg. Cover the container. Do you see bubbles forming around the egg? These are bubbles of CO2 which result from the chemical reaction between the acetic acid in the vinegar and the calcium carbonate in the eggshell. This reaction will dissolve most of the eggshell by day 2. Day 2 ➤ Observe your eggs. Notice that most of the shell has been dissolved by the acetic acid in the vinegar. The shell membrane around the egg is fairly strong. However, the egg without its shell is fragile, so you will need to handle your eggs very gently and carefully! Rinse each egg and measure the weight or circumference of each egg. Record your results for day 2 in the above table. 1a. Did the eggs become heavier/larger or lighter/smaller 1b. What do you think happened to cause the change in the eggs' weight/size? ➤ Empty the vinegar from the container for egg 1 and rinse the container. Put egg 1 back in the container and add water to cover the egg. ➤ Empty the vinegar from the container for egg 2 and rinse the container. Put egg 2 back in the container and add corn syrup to cover the egg. Day 3 2. Compare and contrast the appearance of the egg that has been in water vs. the egg that has been in corn syrup. 3. You may be able to see a layer of water on top of the corn syrup. Where do you think this water came from? Rinse the corn syrup off of egg 2. Measure and record the weight and/or circumference of the egg for day 3 in the table on page 1. 4. Why did the egg placed in water get heavier and bigger? Where do you think the additional weight/volume came from?