genetics and molecular biotechnology homework help

Boost your journey with 24/7 access to skilled experts, offering unmatched genetics and molecular biotechnology homework help

Trusted by 1.1 M+ Happy Students

4.4Trust Pilot

4.4Edu Reviewer

5App Review

4.8Student

4.2Sitejabber

Recently Asked genetics and molecular biotechnology Questions

Expert help when you need it

Q1:2. Given the below DNA sequence and the given Forward primer sequence (highlighted in yellow), design the reverse primer sequence (of a 20bp length) that you would have to purchase if you want to generate a 876bp amplicon. GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTG CTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCC AGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTG ATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGG GGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCA CACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTG CCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGG GGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGAC TGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGA CAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGT GTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGA CAGGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGG TCCTGGGGATAGGGGSee Answer
Q2:In this lab you will first simulate the preparation of a PCR which will be carried out to amplify a fragment of a gene which may contain the causative SNP. The PCR products will then be digested with an enzyme to discover whether the 'normal type' or 'disease type' of the allele is present in your samples. The samples will then be analysed by gel electrophoresis.See Answer
Q3:INSTRUCTIONS Need to do the question given below With the aid of a hand-drawn diagram, explain the procedure which generates size- based photographic representation of chromosomes.See Answer
Q4:Come up with two ideas for starting a biotech company Your task is to come up with two ideas for starting a biotechnology company that uses CRISPR-Cas or another technology to produce something that will sell. You can choose to modify any gene in any species except humans. In humans you can only modify blood cells. 14% of each student's grade will be from the Long-Term Project (LTP), except for students that choose to opt out. You should browse the internet looking for ideas. You should consider the competitive nature of commercialization and choose a gene to edit that could make a whole lot of money. I used to recommend Googling as well as searches on Google Scholar and Pubmed. However, I have found that using Google is so effective that Google Scholar and Pubmed searches are rarely needed. Your task will be to submit two gene ideas in 400 words in the following format: (1) Explain the problem, need, or expected demand (2) Explain what the gene does and the species of organism you want to modify (3) Explain what you want to do with the gene (4) Explain why this would sell (5) Explain why this is doable Feel free to run your idea by me. I will give you feedback on whether the idea is realistic or not and original/innovative or not. If it isn't realistic you will be asked to find another gene.See Answer
Q5: Exercise 4 (continued) GENE EXPRESSION Introduction: Expression systems are designed to produce many copies of a desired protein within a host cell. In order to accomplish this, an expression vector is inserted into a host cell. This vector contains all of the genetic coding necessary to produce the protein, including a promoter appropriate to the host cell, a sequence which terminates transcription, and a sequence which codes for ribosome binding. One expression system was developed in 1986 by W. F. Studier and B. A. Moffatt, who created an RNA polymerase expression system which was highly selective for bacteriophage T7 RNA polymerase. This expression system is commonly known as the T7 expression system. The pET series of vectors have been developed for cloning and expression of recombinant proteins using the T7 system. These plasmids contain a T7 promoter which is specific to only T7 RNA polymerase (not bacterial RNA polymerase), a polylinker to clone in DNA, an antibiotic resistance gene, and a ColE1 origin of replication. The pET-44 vectors are designed for cloning and expression of peptide sequences fused with the Nus protein which has great solubility potential (recall the importance of correct folding). This vector encodes a Nus protein with a N-terminal His-tag to facilitate purification by metal chelate chromatography. Attached is a map for the pET-44 vector series. Without insertion of foreign DNA, the recombinant Nus protein expressed from pET-44 is ~68 kD. As indicated above, the T7 expression system depends on the regulated expression of T7 RNA polymerase, an extremely active enzyme that is encoded in the DNA of bacteriophage T7. The T7 RNA polymerase transcribes DNA beginning within a specific 23-bp promoter sequence called the T7 promoter. Copies of the T7 promoter are located at several sites on the T7 genome, but none is present in E. coli chromosomal DNA. In this expression system, recombinant E. coli cells have been engineered to carry the gene encoding T7 RNA polymerase next to the lac promoter. Typically, the host cell used is E. coli strain BL21(DE3). These cells then are transformed with plasmid vectors that carry a copy of the T7 promoter and, adjacent to it, the DNA encoding the desired protein (see Figure below). When lactose or a molecule similar to lactose, such as IPTG (isopropyl-ẞ-D-thiogalactopyranoside), is added to the culture medium containing these transformed, recombinant E. coli cells, T7 RNA polymerase is expressed by transcription from the lac promoter. The polymerase then binds to the T7 promoter on the plasmid expression vectors, catalyzing transcription of the inserted DNA at a high rate. Since each E. coli cell contains many copies of the expression vector, large amounts of mRNA corresponding to the cloned DNA can be produced in this system. Typically, 10 – 50 percent of the total protein synthesized by these cells after addition of IPTG is the protein of interest. Very high levels of Nus protein lac promoter Multiple T7 RNA polymerases T7 RNA Nus DNA polymerase gene T7 late promoter PET44 Recombinant E. coli chromosome Plasmid expression vector Figure – T7 Expression System - E. coli BL21(DE3) containing pET-44. 41 DAY 1 (REVIEW) Transformation into Expression Host BL21(DE3) For transforming into the expression host BL21(DE3), use 1-2 µl of the pET-44 plasmid (50 ng/μl) and follow your transformation procedure. After the heat shock and dilution, spread cells on LB and LB-Amp plates and incubate overnight at 37°C. Using 100 ng of pET-44 with the competent BL21(DE3) cells, approximately 500 colonies should be obtained per plate with your transformation procedure. Setting up for Option 3 below: Hint: Put this in your notebook. It is Ok to do this at home. You will be provided an ampicillin stock of 100 mg per ml. Write out the calculations for 5 ml LB containing 100 µg per ml of ampicillin, 50 ml of LB containing 100 µg per ml of ampicillin in an Erlenmeyer flask in your notebook. Make these solutions and store them in the refrigerator. DAY 2 Growth and induction: The following protocol is a “suggested/general" protocol. We will modify the protocol as needed; based on how the labs proceed. Write out the protocol that you actually use in your lab notebook. Make sure you save samples at each stage of the purification protocol. You will run all these samples on a gel. IT IS IMPERATIVE THAT YOU SAVE SAMPLES AT EACH STEP TO RUN ON AN SDS GEL. OPTIONS: We will use Option 3: 1) Pick a single colony from the plate of transformed cells and inoculate into 50 ml LB containing 100 μg per ml of ampicillin in a 250 ml Erlenmeyer flask. 2) Alternatively, streak a LB-Amp plate from a glycerol stock of BL21(DE3) cells containing pET-44, incubate overnight at 37°C, and inoculate a single colony into LB media containing ampicillin as above. 3) We will use this method: Pick a single colony from the plate of transformed cells and inoculate into 5 ml LB containing 100 µg per ml of ampicillin, incubate overnight at 37°C. Use this culture to inoculate 50 ml of LB containing 100 µg per ml of ampicillin in an Erlenmeyer flask. a) Pick a single colony from the plate of transformed cells and inoculate into 5 ml LB containing 100 µg per ml of ampicillin, incubate overnight at 37°C. (This will be performed by the lab technician). Transfer the 5ml of culture to the 50 ml flask. Incubate with shaking (100-150 rpm, depends on flask size) at 37°C until OD 600 reaches 0.5-0.7 (about 3-4 hours). (Sample size for O.D reading: 4 ml). Remove ~1.0 ml sample for the uninduced control, centrifuge, and store cell pellet at 0 to - 20°C. You may take the 1 ml from the 4 ml sample you removed for the OD reading. An alternate procedure (which we will not use in this class) place flask in 37°C oven (stationary) overnight and shake the following morning until the appropriate OD 600 is obtained. b) Chill the cells on ice for 15-30 minutes. c) Add IPTG to a final concentration of 0.2mM (100µl of 100mM IPTG (provided) per 50ml of culture). 42 d) Continue shaking at overnight at room temperature at 100 rpm. An alternate procedure (which we will not use in this class) is to shake the cells at 100 rpm@ 37°C for 3-4 hr. Efficient IPTG induction results in reduction of cell growth. Post-induced cultures are typically less than 2X the initial cell density. (Record OD600) e) Following induction, remove ~1.0 ml sample, centrifuge, and store pellet at 0 to -20°C for analysis of total cell protein. You may take the 1 ml from the 4 ml sample you removed for the OD reading. f) Place the flask of the post-induced culture on ice for 10 min or store the cells in the refrigerator. Harvest the cells by centrifugation at 5000xg for 5-10 min at 4°C. Resuspend the cells in 1-1.5 ml of 50mM Tris-Cl (pH 8.0), transfer to eppendorf tube, and centrifuge for ~1 min. Remove the supernatant and store the cells at -20°C or continue with lysis and purification. Protein extraction is typically more effective with frozen cells. DAY 3 Lysis If cells have been stored at -20°C, remove from freezer and thaw at room temperature for 10-15 min. a) For a cell pellet harvested from 40-50 ml of culture, resuspend in 1 ml of Bacterial Lysis Reagent by gently pipetting up and down until the cell suspension is homogenous. Rotate the tube for an additional 10 min at room temperature. Alternatively, invert tube to mix cell suspension every couple min over 10 min. Do not vortex. b) Centrifuge at 12,000 rpm for 8 min to separate soluble and insoluble fractions. The soluble protein is in the supernatant. c) Transfer the supernatant to a clean tube (Soluble Lysate #1). Save for purification. d) Repeat extraction by resuspending the insoluble fraction in 1 ml of Bacterial Lysis Reagent. Gently pipet up and down until suspension is homogeneous. Centrifuge at 12,000 rpm for 8 min e) Transfer the supernatant to a clean tube (Soluble Lysate #2). Save for purification. f) Save 40 μl aliquots of Soluble Lysates #1 and #2 for SDS-PAGE analysis. You will only use 20 ul for the gel on Day 4. This gives you some extra sample in case you need to rerun the gel for any reason. Metal Chelate Affinity Purification Buffers (included) for Metal Chelate Chromatography Binding Buffer: 20mM Tris-Cl (pH 8), 0.5M NaCl, 5mM imidazole Wash Buffer: 20mM Tris-Cl (pH 8), 0.5M NaCl, 20mM imidazole Elution Buffer: 20mM Tris-Cl (pH 8), 0.5M NaCl, 200mM imidazole The metal chelate chromatography columns contain a resin with nickel-nitrilotriacetic acid (Ni-NTA) coupled to cellulose beads. The Ni-NTA matrix binds proteins carrying a stretch of at least six consecutive histidine residues. The Nus protein expressed from pET44 carries such a His-tag sequence to allow affinity purification via the nickel ion bound to the resin matrix. The target protein is recovered by elution with imidazole. 43 The metal chelation chromatography columns are ready to use for rapid purification of His-tagged proteins. Each column is packed with ~0.4 ml of metal chelate resin containing 20% ethanol as preservative. In general, the binding capacity is ~5 mg protein per ml of resin. - 1) In an eppendorf storage rack, place six tubes (12 x 75 mm, included) and three eppendorf tubes (2 ml, included). Label sequentially the 12 x 75 mm tubes – Equilibration, Unbound Soluble Lysate #1, Unbound Soluble Lysate #2, Wash 1, Wash 2, and Wash 3. Label the eppendorf tubes as Elute 1, Elute 2, and Elute 3. 2) Snap off the bottom tip of a column and place in Equilibration tube. Remove top cap and allow the excess packing buffer to drain by gravity to top of gel bed. If column does not begin to flow, push cap back into top of column and remove. If column still does not begin to flow, attach syringe (included) to bottom of column and gently pull out the syringe to start flow. Place column back into tube to drain. 3) Discard drained buffer and place column back into Equilibration tube. Hint: Centrifuge both Soluble Lysate 1 and Soluble Lysate 2 at 12,000 rpm for 8 min (AGAIN). This is to avoid adding any cell debris to the column which will slow the column down. 4) Apply 0.75 ml of Binding Buffer and allow column to drain. Repeat with 0.75 ml of Binding Buffer. 5) Place column into next tube and carefully apply sample from Soluble Lysate #1. Allow sample to fully drain into collection tube. Hint: it is better to leave a little liquid behind than add debris to the column. 6) Remove column, place into next tube, and apply sample from Soluble Lysate #2. Hint: it is better to leave a little liquid behind than add debris to the column 7) After sample has fully drained, remove column and wash three times with 1 ml of Wash Buffer, collecting the flow-through fractions in Wash 1 -3 collection tubes. 8) Following the last wash, place column into first eppendorf tube and elute with 250 μl of Elution Buffer (Remember this would contain your purified product- SAVE IT! Remove 40 ul for gel analysis). 9) Repeat with 400 µl of Elution Buffer, collecting eluate in tube labeled Elute 2 (Remember this would contain your purified product- SAVE IT! Remove 40 ul for gel analysis). 10) Repeat with 400 μl of Elution Buffer, collecting eluate in tube labeled Elute 3 (Remember this would contain your purified product- SAVE IT! Remove 40 ul for gel analysis). DAY 4 SDS-PAGE Analysis Analyze column fractions on 7.5-10% SDS gels. The Nus protein expressed from pET-44 runs at ~68 kD. Some degradation of the purified Nus protein will be observed due to absence of protease inhibitors. Protein assays will not be run for this lab, however if protein assays are performed on elution fractions, load 5-10 ug. Most of the protein eluted from the Ni-NTA column will be in the Elute 2 fraction (1-2 µg/µl). If protein assays are not performed, run ~10µl from Elute 1, 2 and 3. Loading the gel: i. If total cell protein from uninduced and induced cells is also to be analyzed, resuspend cell pellets (1 ml cell cultures) in 80 µl Laemmli buffer and load 20 µl. 44 ii. For the other column fractions being analyzed, Soluble Lysate 1 and Soluble Lysate (15 μl) add 15 µl of Laemmli buffer. Load 30 μl of each sample on the gel. iii. For Elute 1, 2 and 3, take 15 µl samples and add 15 µl Laemmli buffer. Load 30 µl of each sample on the gel. iv. Do not forget to load a Kaleidoscope marker/ladder. It is OK to load marker in two lanes if available. It is sometimes useful to heat all the samples to 95°C for 5 minutes prior to loading. Coomassie Colloidal Blue Staining of SDS gels The Colloidal Blue Staining Reagent uses the colloidal properties of Coomassie G-250 dye for protein staining of polyacrylamide gels. The reagent stains only protein and allows bands to be viewed directly during the staining process. Standard Procedure 1) Following SDS-PAGE, remove gel and place in clean dish. Rinse gel three times with 100 ml of deionized water (5 min incubation each wash). 2) Mix the Colloidal Blue Stain Reagent just before use by gently inverting and swirling the reagent bottle. 3) Discard water wash and add 20-30 ml of the Colloidal Blue Stain Reagent to the gel. Gently shake or periodically agitate. Stain intensity should reach maximum within 2 hr. Gels may be stained overnight without increasing background. 4) If desired, destain with 100 ml of water for 1-2 hrs. Alternative Procedure for Faster Staining: We will use this procedure 1) Following SDS-PAGE, place gel in clean dish. Rinse gel twice with 100 ml water pre-heated to 70-90°C (5 min each wash). 2) Mix the Colloidal Blue Stain Reagent just before use by gently inverting and swirling the reagent bottle. The instructor will do this step and pre-heat the dye for you. 3) Discard water wash from gel and add 20-30 ml of the pre-heated Colloidal Blue Stain Reagent. Protein bands should be visible within 5-10 min. Destain gel with 100 ml of water for 10-20 min. You may take a picture immediately or leave your gel in water in the refrigerator till the next class. Hint: This is data, it should go in your notebook. Alternate procedures (which we will not use in class): Microwave gel plus stain for 1 min or until solution begins to boil or put the tray containing the gel and stain reagent may be placed on a hot plate and heated until the solution begins to boil. Remove from hot plate. Protein bands should be visible within 5-10 min. If desired, destain gel with 100 ml of water for 10-20 min. References: This document has been adapted from “Bacterial Transformation” http://plaid.hawk.prattsburgh.edu/faculty/slsh/tranformation.html Transformation and gene expression protocol has been adapted from the procedure suggested by Protein Express, Inc. 45 45See Answer
Q6:1. In tomato, tall plant growth dominates over short plant growth, smooth epidermis over rough epidermis. A cross between two plants produced the following number of offspring: 208 high smooth, 9 high rough, 6 low smooth, 195 low rough plants. Explain the results. Identify the genotypes of the original plants and their phenotypes 2. Construct a genetic map using the results of two analyzing crosses of AaBbCc triheterozygotes: Phenotypic classes Crossbreeding №1 Crossbreeding №2 I ABC 126 84 ABC 10 76 AbC 64 82 Abc 62 78 aBC 68 86 aBc 70 74 abC 14 82 abc 133 80 547 642 totalSee Answer
Q7: • dystrophy, etc ARTICLE SOURCES: You are able to use multiple databases to help find relevant information for your topic such as Google Scholar, PubMed, and Alabama Virtual Library, etc. Make sure that any source you do choose meet the following guidelines: - You may only consider articles published after 2014 It must have at least three (3) pages of written content It must be relevant to scientific research (ex. genetics, population genetics, DNA, RNA, Proteins etc.) PART ONE - ARTICLE ANNOTATION: In order to properly communicate the information of your topic, you will need to do some background research on the topic. Begin your background research by conducting a SCIENCE ARTICLE SHARE GENETICS PROJECT PURPOSE/BACKGROUND A major part of science is investigating. This assignment will allow you the chance to follow science news stories and engage in exploration of different topics relevant to the material we have already learned or what we will learn in the near future. This particular project will focus on Genetic Disorders. There are three parts to this project that you will need to submit in order to be eligible for full credit PROJECT COMPONENTS: Annotated Article (15 points) Article Review and Summary (40 points) Presentation (45 points) Now, it is time to decide which topic you and your partner will present to the class. SAMPLE TOPICS Cystic fibrosis, DiGeorge syndrome, Down syndrome, Duchenne muscular general search for articles that are relevant to the topic you want to present. Once you have found a few, choose one to be your primary source and use the other articles to provide additional information about your topic. Next, read and annotate the chosen article. For your annotations you can write down vocabulary terms, key concepts, things that you are unfamiliar with or believe to be key to understanding the main idea of the article, etc. From this exercise you will have a pretty good idea of what background information the class is likely to already understand, and which information you will need to research and elaborate on during your presentation. In the end, you should be able to define all technical terms and generally explain any key concepts that would help your audience understand your topic. The other articles that you found during your background research will serve as support information for your presentation. In the end you should have at least three (3) scientific/scholarly articles as your sources. You will need to agree on a topic over the next few days and finalize your article/topic no later than Friday, April 5, 2024. Once you have identified your potential topic, one group member must complete the topic request form. Topics may not be duplicated in one class period therefore, they must be officially approved by the teacher. Articles/Topics will be officially approved in the order in which they are received. PART TWO - ARTICLE SUMMARY AND CRITIQUE: This portion of your project should be at least one page long double spaced. It includes two parts: the article summary and critique. SUMMARY: (250 words) This is where you will pick out major concepts and ideas from the article to provide an overview. In this section, you may also include interesting facts that you learned while reading this article. Make sure when you use information from the article that you are citing the article using its title or the last name of the author. Critique: (250 words) This is where you will give honest feedback about the article. Decide what you enjoyed about the article and what would have made it better. Was it too long? Was it well organized and did it have a good flow? For every negative critique you must provide a suggestion of how to make it better in the future. PART THREE - PRESENTATION: You may choose to use a PowerPoint (6-8 slides; not including title slide) or design a website to present the material found from your background research. You are expected to fill a 5 minute time block. This will allow for multiple groups per presentation date plus ample time for questions and discussion from the teacher and peers. Your presentation should include the following information Source Citation(s) ex. title, author(s), date, literature source in APA Format. Table of Contents • Technical vocabulary terms (you must be able to define them) • Purpose/Research Question (Learning Objective) • Introduction/Background ● Key Concepts (at least 5) - - Symptoms or Physical Attributes associated with the disease How is it inherited? Pedigree Chart or Punnett Square Is it a dominant or recessive trait? Are there any current Treatments or Genetic Technology to help fight this disease? Which ethnic and age demographics does it impact the most? Death/Survival Rate What is the Importance of the research of this disease? Key Scientists involved in research of the disease. Personal Connection to Disorder • Audience Interaction · You may also incorporate images, figures, diagrams, maps, etc, to help illustrate key points. ***Do not clutter your slides with too much text or irrelevant figures. All parts of the project need to be submitted on time along with your annotated printed copy of the article. Participation in the Audience: Your responsibility as a member of the audience is to ask questions after the presentation. Your questions may be as simple as requesting the definition of a technical term not defined during the presentation, or clarification of a concept. PRESENTATION DATES: Project due April 15, 2024 Presentations will begin April 15, 2024 - April 18, 2024. NAME: PRESENTATION DATE: TOPIC: PRESENTATION RUBRIC POINTS AVAILABLE POINTS RECEIVED 10 Points Category Grammar Mechanics: Student submitted a presentation with less than 3 grammatical errors Quality of Information: Students presented relevant and accurate information to the class. Organization: The students arrived with all materials and presented a well-prepared presentation. Knowledge of Content: Students were able to present their research topic without relying heavily on their notes. 15 Points 5 Points 15 points ARTICLE SUMMARY AND CRITIQUE RUBRIC Grammar Mechanics: Student submitted a presentation with less than 3 grammatical errors. The student cited the article correctly. Quality of Information: Students include the most relevant and accurate main ideas in their summary. Student provide a balanced sample of positive and negative attributes about the article. The student Organization: The summary is written in a standard flow of logic. 15 Points 15 Points 10 Points ACADEMIC INTEGRITY POLICY Academic integrity and honesty are fundamental values in a student's education. Students are expected to do their own work to gain appropriate credit. Students, therefore, are expected to submit their own work at all times. To commit academic dishonesty is to violate anyone's or one's own personal honesty, integrity, and character; and is not limited to any single type of action. It unacceptable behavior for students to ask, borrow, copy, or rewrite another person's work or thinking. In addition, any participation in academic dishonesty cheapens and degrades the academic quality of the entire school or institution. Consequently, A STUDENT MUST NOT: turn in an assignment, homework, test, paper, or project that is not entirely his or her own work, effort, or ideas; submit the same paper or project for two or more classes without the knowledge and approval of all teachers; use another person's ideas, structures, words, or phrases without giving proper acknowledgements or in other words plagiarize. PLAGIARISM: is scholarly theft, and it is defined as the unacknowledged use of secondary sources. More specifically, any written presentation in which the writer does not distinguish clearly between original and borrowed material constitutes plagiarism. It may be intentional or unintentional; thus, the student is responsible for his or her honesty and truthfulness in their scholarship. This definition of plagiarism is also applicable to all Internet material. Borrowing or buying a research paper written by someone else also constitutes plagiarism. Because students, as scholars, must make continuous use of the concepts and the facts developed by other scholars, plagiarism is not mere use of another's facts and ideas. However, it is plagiarism when students present the work of other scholars as if it were their own work. There are a number of instances where students can be certain that they are not plagiarizing: referring to commonly known facts is not plagiarism students may refer in their own words to generally known and widely accepted ideas or theories without fear of plagiarism as long as they do not copy the plan, structure, outline, or organizational scheme used by another scholar. Plagiarism is committed in a number of ways: a. reproducing another author's writing as if it were one's own. b. paraphrasing another author's work or ideas without citing the original owner of the material. C. d. borrowing another author's ideas, even though they are reworded without giving credit to the original owner. copying another author's organization, structure, outline, or plan without giving credit. Plagiarism is avoided when students give credit (in parenthetical citation style) to the source in the following instances: a. when quoting directly from someone else's writing. A direct quotation must always be enclosed in quotation marks. Using three words or more from the original source material is considered quoting rather than paraphrasing and thus should be treated accordingly. b. when paraphrasing someone else's writing. To paraphrase means to restate a passage from someone else's writing completely in one's own words. However, a parenthetical citation is still required because ideas and concepts were copied. C. when following the outline or structure of another author's argument, explanation, or theory--even though the material is summarized in one's own words. The standard penalty for plagiarism is a zero grade for the assignment in which the plagiarism occurs.See Answer
Q8:3. The recognition cutting sites of 2 different enzymes (enzymes A: blue star; enzyme B: red triangle) are shown in the map below. In your answer include: a) A prediction of the size (in bp) of the resulting fragments after digestion of the amplicon with the two enzymes mixed together (Mix), when each enzyme is used separately (A and B) and when no enzyme (NO) is used. b) A drawing of these fragments onto the graph below to represent a gel electrophoresis. You can either recreate the picture e.g. in PowerPoint/paint/others and then paste this in your research paper or print this, draw on it, and take a picture of it and then upload this on the research paper. Doesn't need to be perfect but the bands size difference MUST be clear.See Answer
Q9:In this lab you will first simulate the preparation of a PCR which will be carried out to amplify a fragment of a gene which may contain the causative SNP. The PCR products will then be digested with an enzyme to discover whether the 'normal type' or 'disease type' of the allele is present in your samples. The samples will then be analysed by gel electrophoresis.See Answer

TutorBin Testimonials

I found TutorBin Genetics And Molecular Biotechnology homework help when I was struggling with complex concepts. Experts provided step-wise explanations and examples to help me understand concepts clearly.

Rick Jordon

TutorBin experts resolve your doubts without making you wait for long. Their experts are responsive & available 24/7 whenever you need Genetics And Molecular Biotechnology subject guidance.

Andrea Jacobs

I trust TutorBin for assisting me in completing Genetics And Molecular Biotechnology assignments with quality and 100% accuracy. Experts are polite, listen to my problems, and have extensive experience in their domain.

Lilian King

I got my Genetics And Molecular Biotechnology homework done on time. My assignment is proofread and edited by professionals. Got zero plagiarism as experts developed my assignment from scratch. Feel relieved and super excited.

Joey Dip

Popular Subjects for genetics and molecular biotechnology

You can get the best rated step-by-step problem explanations from 65000+ expert tutors by ordering TutorBin genetics and molecular biotechnology homework help.

TutorBin helping students around the globe

TutorBin believes that distance should never be a barrier to learning. Over 500000+ orders and 100000+ happy customers explain TutorBin has become the name that keeps learning fun in the UK, USA, Canada, Australia, Singapore, and UAE.