Homework Help
pharmaceutical science homework help

Pharmaceutical Science Assignment Help

Boost Your Knowledge and Grades with Top-Notch Pharmaceutical Science Homework Help

Trusted by 1.1 M+ Happy Students

4.4Trust Pilot

4.4Edu Reviewer

5App Review

4.8Student

WhatsApp Support

Get Instant
Online Homework Help
via WhatsApp

Get instant homework help from top tutors—just a WhatsApp message away. 24/7 hw help support for all your academic needs!

★★★★★

2M+ students trust TutorBin

Your WhatsApp Number

⚡ Instant reply

🔒 100% private

👨‍🏫 Top tutors

🌍 All subjects

^*Get instant homework help from top tutors—just a WhatsApp message away. 24/7 support for all your academic needs!

2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee

Popular Subjects for Pharmaceutical Science Homework Help

You can get the best-rated step-by-step problem explanations from 65000+ expert tutors when you ask TutorBin subject experts, “Do my Pharmaceutical Science homework.”

Do My Computer Science HomeworkExplore our project samples to tackle computer science problems and complete your assignments accurately.

Know More

Do My Accounting HomeworkExplore our project samples to tackle accounting problems and complete your assignments accurately.

Know More

Do My Chemistry HomeworkExplore our project samples to tackle chemistry problems and complete your assignments accurately.

Know More

Do My Physics HomeworkExplore our project samples to solve physics problems and complete your assignments accurately.

Know More

Do My Geometry Homework Check out our project samples to solve geometry problems and complete your assignments accurately.

Know More

Do My Finance HomeworkExplore our finance project samples to master complex concepts and excel in your assignments.

Know More

Do My Programming HomeworkExplore our programming project samples to tackle coding challenges and complete your assignments accurately.

Know More

Do My Python Homework Explore our Python project samples to tackle coding challenges and complete your assignments accurately.

Know More

Recently Asked Pharmaceutical Science Questions

Expert help when you need it

Q1:1. Identify main metabolic enzymes involved in elimination of clozapine. a) Tabulate median clozapine maximal plasma concentrations (Cmax), area under plasma concentration-time curve (AUC) and clearance (Dose/AUC) in non-smokers vs. heavy smokers (>20 cigarettes/day). Assess percent change in these parameters in smoker vs. non-smoker patients. Explain reasons for potential differences in parameters between smokers and non-smokers. b) Comment whether you would recommend a change in clozapine dose in heavy smokers and why.See Answer
Q2:3. Explain whether you expect clozapine Cmax to change following the initiation of smoking cessation and whether there would be any consequences of smoking cessation on the patient's safety and efficacy of this drug. What effect would nicotine replacement therapy have on clozapine metabolism?See Answer
Q3:4. Identify another drug example where pharmacokinetics of a drug differs between smokers and non- smokers. List either clearance, AUC or t1/2 for that drug in smokers vs. non-smokers, explain reasons for these differences and include relevant reference. Comment on any therapeutic implications/ clinical action for that drug example for i) the patient starting smoking and for ii) the patient stopping smoking.See Answer
Q4: 1. What is the role of community pharmacy in patient education?See Answer
Q5:Write a one paragraph response explaining the four different perspectives below on human cloning. Introduce the authors’ full names (titles aren’t necessary for this paragraph, but they would be for an essay) to indicate each of their different opinions. Consider the most strategic way of how to organize/structure your paragraph to show connections and contrasts between each of the source’s arguments Use transitions carefully, as they will show how you relate the articles to each other. Perspective 1: Patricia Baird, “Should Human Cloning be Permitted?” “...In conclusion, using nuclear-transfer cloning to allow people to have a child introduces a different way of reproduction for our species. Once we breach this barrier, it leaves us with no place to stop. Given all the problems outlined, the reasons for permitting cloning to produce a person are insufficiently compelling. Even in the few circumstances where the case for human cloning seems justified, there are alternative solutions. We are at an appropriate stopping place on a slippery slope. Not all reasons why a person might wish to copy his or her cells are unethical, but given there are other options open to people wishing to form a family, concerns about individual and social harms from cloning are strong enough that it is not justified to permit it.” Perspective 2: Chris MacDonald, “Yes, Human Cloning Should be Permitted.” “The fact that a portion of society—even a majority—finds an activity distasteful is insufficient grounds for passing a law forbidding it....human cloning for reproductive purposes has legitimate, morally acceptable applications—for example for infertile couples, and for gay couples.” Perspective 3: Jacob M. Appel, “Should We Really Fear Reproductive Human Cloning?” “In an ideal world, human reproductive cloning would be safe, legal and rare. I say rare because my guess is that the vast majority of people, myself included, would have little desire to raise cloned offspring. After all, it is now possible to clone pet dogs--but few of us would choose to spend a spare $150,000 on such a venture. Yet thirty-eight years after James Watson's seminal essay, "Moving Toward the Clonal Man" called for increased public debate on this promising and perplexing subject, I don't believe that we should be so quick to greet cloning technology with a permanent injunction. Instead, what human reproductive cloning requires at the moment is a yellow light, telling us to proceed with extreme caution, until we know with confidence whether the technology can ever be used to produce healthy babies.” Perspective 4: Leon Kass, “The Wisdom of Repugnance” “We are repelled by the prospect of cloning human beings not because of the strangeness or novelty of the undertaking, but because we intuit and feel, immediately and without argument, the violation of things that we rightfully hold dear. Repugnance, here as elsewhere, revolts against the excesses of human wilfulness, warning us not to transgress what is unspeakably profound. Indeed, in this age in which everything is held to be permissible so long as it is freely done, in which our given human nature no longer commands respect, in which our bodies are regarded as mere instruments of our autonomous rational wills, repugnance may be the only voice left that speaks up to defend the central core of our humanity.” See Answer
Q6:b. C. d. What was the independent variable in this experiment? What was the dependent variable? What were the standardized variables?See Answer
Q7:e. f. g. Do the results support your hypothesis? Explain. At which temperature was the rate of osmosis greatest? What can you conclude about the effects of temperature on the rate of osmosis? Answer in terms of molecular energy.See Answer
Q8:h. Name at least two possible sources of error in this experiment. How could this experiment be improved?See Answer
Q9:Variables Table 1 - Osmosis: Effect of Temperature Cold Beaker Water temperature Tube mass Tube firmness Warm Beaker Room Temp Beaker Water temperature Tube mass Tube firmness Before After % Change Observations Water temperature Tube mass Tube firmnessSee Answer
Q10:HANDS-ON ACTIVITY#1: 1. Get 2 transparent glasses (same size) 2. Put the same volume of water in both of them. In one of the glasses put cold water and in the other glass put hot water. 3. Place the 2 glasses side by side and let the water sit for a few seconds. 4. Put a drop of food dye in each of the glasses. Use your cell phone to take a picture of this hands-on activity. You will need to submit this picture and your photo ID to DB 2. Answer the following questions: Why does 1 drop of the dye stain the entire volume of water? Does the staining of the entire volume of water happen faster/slower/or at the same speed in the hot water compared to the cold water? Why? HANDS-ON ACTIVITY#2: This experiment will take you 3 days to complete. Perform the experiment and answer questions 1 to 7 in this hand-out. Use your cell phone to take pictures of this hands-on activity. You will need to submit these pictures and your photo ID to DB 2. An unfertilized chicken egg contains a large cell surrounded by egg white, a shell membrane, and an egg shell. You will investigate how the size of an egg changes when the eggshell is removed and the egg is placed in different types of liquid. ➤ Get 2 eggs. To begin, record the weight or circumference of each egg in the day 1 row in the table. (Measure the circumference around the widest part, not lengthwise.) Day 1 2 Egg 1 Egg 2 Weight (grams) (or circumference (cm)) Weight (grams) (or circumference (cm)) (with shell) (with shell) (after a day in vinegar most of shell removed) (after a day in vinegar: most of shell removed)See Answer
Q11:3 (after a day in water) (after a day in corn syrup) Put each egg in a container labeled Egg 1 or Egg 2. Pour in enough vinegar to cover the egg. Cover the container. Do you see bubbles forming around the egg? These are bubbles of CO2 which result from the chemical reaction between the acetic acid in the vinegar and the calcium carbonate in the eggshell. This reaction will dissolve most of the eggshell by day 2. Day 2 ➤ Observe your eggs. Notice that most of the shell has been dissolved by the acetic acid in the vinegar. The shell membrane around the egg is fairly strong. However, the egg without its shell is fragile, so you will need to handle your eggs very gently and carefully! Rinse each egg and measure the weight or circumference of each egg. Record your results for day 2 in the above table. 1a. Did the eggs become heavier/larger or lighter/smaller 1b. What do you think happened to cause the change in the eggs' weight/size? ➤ Empty the vinegar from the container for egg 1 and rinse the container. Put egg 1 back in the container and add water to cover the egg. ➤ Empty the vinegar from the container for egg 2 and rinse the container. Put egg 2 back in the container and add corn syrup to cover the egg. Day 3 2. Compare and contrast the appearance of the egg that has been in water vs. the egg that has been in corn syrup. 3. You may be able to see a layer of water on top of the corn syrup. Where do you think this water came from? Rinse the corn syrup off of egg 2. Measure and record the weight and/or circumference of the egg for day 3 in the table on page 1. 4. Why did the egg placed in water get heavier and bigger? Where do you think the additional weight/volume came from?See Answer
Q12:5. What do you think happened to cause the change in weight/size of the egg placed in corn syrup? 6a. Recall that each egg is surrounded by a shell membrane. Based on your observations, which of the following do you think can cross this membrane? a. both water and the proteins in the egg white b. water, but not the proteins in the egg white c. the proteins in the egg white, but not water d. neither water nor the proteins in the egg white 6b. What evidence supports your conclusion? 7. The shell membrane that surrounds the egg is a selectively permeable membrane. Explain why "selectively permeable" is a good way to describe this membrane.See Answer
Q13: Imagine you have been recently hired by a biotech company. On your first day of work, the manager wants to see your ability to engineer proteins, so they ask you to design a protein expression system for making any protein you wish, but it should have some way after expression in E. coli BL21 to be purified by affinity chromatography. The manager gives you some advice and recommends you produce the protein with a HisTag so you can purify your protein with nickel affinity column chromatography which the company uses regularly. To make things easier since its your first day, the manager gives you a tube containing a proprietary expression vector that only your company has called pET 14p and it is this vector that you will need to use to insert the gene for the protein that you choose to make and purify. Before getting started on the actual experiments, the manager wants you to design the experimental setup and provide a report. The following 6 items (marked w/ **) should be included in your report along with an explanation for each step. Steps to follow in this design project for your report 1) Choose a protein that you are interested in purifying. -This can be any protein (there are millions possible so no two students would by chance choose the same protein) - You can use resources like NCBI (https://www.ncbi.nlm.nih.gov/protein/ ) or KEGG (https://www.genome.jp/kegg/pathway.html), among others to find a protein you are interested in making. **(List the name of the protein you plan to make and the organism it comes from) 2) Find the amino acid sequence of that protein and then find the DNA sequence needed to make that amino acid sequence. -The amino acid sequence may be found at the links above. DNA sequences may be found at NCBI or KEGG as well or deduce it here: https://en.vectorbuilder.com/tool/codon-optimization.html **(List the amino acid sequence and its corresponding DNA sequence for this protein you plan to make) 3) Choose a set of restriction enzyme that you can use to cut your pET14p expression vector but that will not cut the important protein coding regions of the gene you are inserting into pET14p -NOTE: You should make sure that the coding sequence of your selected protein you choose does not already contain the sequences recognized by those restriction enzymes you selected to cut your pET14p vector or else it will cut your gene at a place you don't want. You can use this tool http://nc2.neb.com/NEBcutter2/ to check if your gene (DNA sequence that codes for your protein of interest when translated) contains the sequences recognized by that restriction enzyme that you have chosen. If the gene does contain a sequence that will be cut by your enzymes selected to cut the pET14p vector then you'll either have to choose a different enzyme or select a different codon for those positions on that gene so that it can make the same protein but not be cut improperly by the restriction enzymes you plan to use. Because you will be expressing your protein for purification using Nickel affinity chromatography, make sure that your choice of cutting location does not remove the HisTag sequence from your vector. **(List the names of the restriction enzymes you will use to cut the pET14p vector and their recognition sites. Also show where in the pET14p vector that it cuts) 4) Imagine you have access to the DNA template of this gene. Choose the appropriate forward primer and reverse primer that you will need to PCR this gene from your template. Make sure that your primers have 5' ends that possess the corresponding restriction sites needed to later insert the PCR product into your pET14p vector. - NOTE: You will need your primers to have approximately the same melting temperature (within 2 degrees of each other) and they should be between 55°C to 65°C. You may find this tool useful http://www.biophp.org/minitools/melting_temperature/demo.php (you can select basic Tm). Remember that your reverse primer sequence would be the reverse complement of the gene sequence you had chosen (if you are looking at the coding sequence in the proper way) and as such you may find the following tool useful for getting the reverse complement: http://www.bioinformatics.org/sms/rev_comp.html **(Provide the forward and reverse primer DNA sequences from 5' to 3' and their expected melting temperature...underline the restriction sites on each primer) 5) Show your plasmid containing the recombinant DNA for your gene. Imagine that you have now conducted the PCR successfully with your primers on your gene of interest to get a PCR product and that you have cut the PCR product using the same restriction enzymes from step 3 that you used to cut the vector. After ligating the cut PCR product into the cut pET14p vector you will have a complete plasmid. **(Show what the DNA sequence will look like for the ligated DNA of your final complete plasmid but just show the region between the T7 promoter and T7 terminator after you have ligated your gene into the vector making sure to underline the restriction sites and placing in bold (or highlight in yellow) the new sequence of your gene that you inserted into the vector) 6) Assume you have now transformed E. coli with this complete plasmid DNA including your gene and it worked to make the protein that you wanted. Show the protein sequence of your final product that would result from expression of this plasmid. **(Show the translated DNA sequence from step 5 so please show the amino acid sequence of what your expressed protein would be. Remember that it will need to included the His-tag in the same frame so you must check if your open reading frame makes sense. You can use an online translation tool like: https://web.expasy.org/translate/. Show what the amino acid sequence will look like if you were to express this protein by translating the region between the first Methionine after the Ribosome Binding Site until you reach the first stop codon). If you do see a stop codon prior to that then your reading frame is likely mis-aligned and you will nee to re-adjust your forward PCR primer to either include an additional nucleotide or two nucleotides to get your insert it into the correct reading frame with the rest of your pET 14p vector. This additional nucleotide (or two) can be placed between the restriction site and the start of your gene when designing your forward primer. PET-14p sequence landmarks T7 promoter T7 transcription start His Tag coding sequence Multiple cloning sites (KpnI - Spe I) T7 terminator pBR322 origin bla coding sequence 646-662 645 554-571 510-526 404-450 Sca (4156) 2845 Pvu I(4046) 3606-4463 Pst I(3921) Eam1105 I(3676). HgiE II(3369) AlwN I(3199) Aat II(4598) Ssp I(4480) EcoR I(4669) Apo I(4669) Cla I(24) Hind III(29) <j「3606-4463) ori (2845) Bpu1102 I(458) Nhe I(229) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) Sph 1(874) EcoN I(934) -Sal I(959) PshA I(1024) PET-14P (4671bp) Eag I(1247) Nru I(1282) ApaB I(1360) BspLU11 I(2783) Afl III(2783) Sap I(2667) Bst1107 I(2554) BsaA I(2535) Tth111 I(2528) BsmB I(2424) Pvu Il(2374) BspM I(1362) Bsm I(1667) Msc I(1754) Bpu10 I(1889) Bsg I(1943) PET 14p Nhe I(229) BglII T7 promoter primer #69348-3 T7 promoter Bpu1102 I(458) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) XbaI You can check the sequence recognized by the restriction sites by searching the names of the enzymes on http://www.neb.com/ rbs means the ribosome binding site ▶rbs AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAAC GGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA NcoI His Tag Spe I Ball KpnI TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCC TGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGC TAAC AAAGCCCGA MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuVal ProArgGlySerThrSerGlyGInVal ProA laAlaAsnLysAlaArg Bpu1102 I thrombin T7 terminator AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC TAAACGGGTCTTGAGGGGTTTTTTG LysGluAlaGluLeuAlaAlaAlaThгAlaGluGInEnd T7 terminator primer #69337-3 Same as above but text can be copied for your convenience: AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGCTAACAAAGCCCGA AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGSee Answer
Q14:3. The following metabolic pathway exists in a strain of bacteria. The bacteria require product D to survive. The three enzymes required to produce D are controlled by three separate genes (genes 1 to 3). A enzyme 1 B enzyme 2° C enzyme 3*D Assume that this pathway is under the control of an operon. a) In the space provided below, draw the operon for this biochemical pathway. [2 A] b)Illustrate a scenario when the levels of D are HIGH (i.e. the bacteria would not require the enzymes to produce D) [2 A] 4. The gel below, was produced by DNA sequencing. What was the original DNA template strand sequence? [4T] ddCTP ddGTP ddTTP ddATP | | |/n5. During an investigation of the promoter region of a gene you apply heat to two sections of DNA that you believe could be a promoter region. One region unwinds at 80 degrees Celsius and the other unwinds around 60 degrees Celsius. Which of the two strands contains the promoter? Explain. [4 T] 6. Use labelled diagrams incorporating the concept of the "Central Dogma of Molecular Genetics" to illustrate how a mutation can lead to disease. [4 C]See Answer
Q15: Introduction This assignment aims to deepen your understanding of the toxicological impacts of specific com- pounds one may be exposed to in occupational and public health contexts. It is structured to develop your research skills, enhance your critical thinking, and engage with scientific literature and Artificial Intelligence (AI). You are required to use ChatGPT 3.5 (no other AI model may be used) for initial research on one question, while the rest of the assignment must be based on in- formation gathered from scholarly sources (e.g., academic journals and books) and written in your own words. Note: you may have to sign up for ChatGPT, but it is free and you do not need to pay. Please read all the following instructions carefully. Students are assigned different toxicants based on the first letter of their LAST name: • A-F: Formaldehyde . G-L: Benzene M-R: Asbestos . S-Z: Glyphosate General Instructions For Questions 1-4, do not use ChatGPT. Base your answers on scholarly articles, books, and other reputable sources. There is no limit to the number of sources you may consult, but be careful and consider if you have enough. • For Question 5, use ChatGPT 3.5 for preliminary research. Compare its response with the information you found in academic sources, critically evaluating the information. The output does not count towards your word count. • Your responses should not exceed an overall total of 1000 words for the entire assignment (break up this number as you wish amongst the questions). • Include in-text citations and a bibliography in APA citation style (don't forget to cite the use of ChatGPT as well!). In text citations do not count towards the word count. 1 Formaldehyde Toxicology 1.1 Questions 1. Overview of Formaldehyde: Research and describe formaldehyde, focusing on its common sources of exposure in occupational and public health settings. 2. ADME Principles: Explain the Absorption, Distribution, Metabolism, and Excretion (ADME) of formaldehyde in the human body. Highlight the key factors that influence its toxicokinetics 3. Mechanism of Toxicity: Detail the mechanism by which formaldehyde exerts toxic effects on the human body. 4. Case Study Analysis: Utilize academic literature to analyze a case study where formalde- hyde exposure led to significant health issues. 5. Chat GPT Comparison: Use ChatGPT to obtain information about formaldehyde's health effects by using the query Can you provide an overview of the health effects and ADME principles related to formaldehyde exposure in 100 words? Run this once only and provide the output from Chat GPT. Compare this with what you have found from academic sources, discussing any discrepancies or confirmations. 2 Benzene Toxicology 2.1 Questions 1. Overview of Benzene: Using scholarly literature, discuss the properties of benzene and its common uses that lead to occupational or public health exposures. 2. ADME Principles: Explain the Absorption, Distribution, Metabolism, and Excretion (ADME) of benzene in the human body. Highlight the key factors that influence its toxi- cokinetics 3. Mechanism of Toxicity: Explain how benzene affects human health, including its carcino- genic potential. 4. Case Study Analysis: Examine a case from academic sources where benzene exposure caused health issues. Cabe Buddy T hyde exposure led to significant health issues. vor avere te arta 2 Benzene Toxicology a cabe boudy WHOFU TUTTarge 5. ChatGPT Comparison: Use ChatGPT to obtain information about formaldehyde's health effects by using the query Can you provide an overview of the health effects and ADME principles related to formaldehyde exposure in 100 words? Run this once only and provide the output from Chat GPT. Compare this with what you have found from academic sources, discussing any discrepancies or confirmations. 2.1 Questions 1. Overview of Benzene: Using scholarly literature, discuss the properties of benzene and its common uses that lead to occupational or public health exposures. 2. ADME Principles: Explain the Absorption, Distribution, Metabolism, and Excretion (ADME) of benzene in the human body. Highlight the key factors that influence its toxi- cokinetics 3. Mechanism of Toxicity: Explain how benzene affects human health, including its carcino- genic potential. 4. Case Study Analysis: Examine a case from academic sources where benzene exposure caused health issues. 5. Chat GPT Comparison: Use ChatGPT to obtain information about benzene's health effects by using the query Can you provide an overview of the health effects and ADME principles related to benzene exposure in 100 words? Run this once only and provide the output from ChatGPT. Compare this with what you have found from academic sources, discussing any discrepancies or confirmations. Submission Guidelines • Submit your assignment as a single .PDF document, clearly indicating the toxicant based on your last name. Include question numbers for organization; a title page is not required. • Ensure your work is clearly written, well-organized, and demonstrates a comprehensive un- derstanding of the toxicological effects of the investigated compound. • The critical analysis in Question 5, comparing ChatGPT's information with scholarly sources, will demonstrate your ability to discern credible information and synthesize knowledge - and demonstrate why AI is not always right! Marking Rubric There are a total of 70 points available based on the following criteria: Criteria 1. Understanding of the Topic (20 Points): Demonstrates a thorough knowledge of the chosen chemical, including exposure sources and toxicity mechanisms. 2. Analysis and Critical Thinking (20 Points): Effectively analyzes case studies and evaluates ChatGPT's insights against academic sources. 3. Use of Academic Sources (10 Points): Uses scholarly sources appropriately, with accu- rate citatio and bibliography according to the specified style. 4. Quality of Writing (10 Points): Presents information clearly and coherently, with proper grammar and spelling. Please do not use bullet points. 5. Adherence to Guidelines (10 Points): Complies with all instructions, including word count, correct chemical selection, and submission format. Important Note Selecting the incorrect chemical based on your last name results in a score of 0. It's M my.torontomu | my.torontomu X M Assignments - OHS322 011/0 X → OHS 322 Term Assignment 20 X A Online Homework Help - Best X File /Users/alyaankamran/Downloads/OHS%20322%20Term%20Assignment%202024.pdf OHS 322 Term Assignment 2024.pdf G screenshot on mac - Google 4 / 4 100% + | A • Ensure your work is clearly written, well-organized, and demonstrates a comprehensive un- derstanding of the toxicological effects of the investigated compound. • The critical analysis in Question 5, comparing ChatGPT's information with scholarly sources, will demonstrate your ability to discern credible information and synthesize knowledge - and demonstrate why AI is not always right! Marking Rubric There are a total of 70 points available based on the following criteria: Criteria 1. Understanding of the Topic (20 Points): Demonstrates a thorough knowledge of the chosen chemical, including exposure sources and toxicity mechanisms. 2. Analysis and Critical Thinking (20 Points): Effectively analyzes case studies and evaluates Chat GPT's insights against academic sources. 3. Use of Academic Sources (10 Points): Uses scholarly sources appropriately, with accu- rate citations and bibliography according to the specified style. 4. Quality of Writing (10 Points): Presents information clearly and coherently, with proper grammar and spelling. Please do not use bullet points. 5. Adherence to Guidelines (10 Points): Complies with all instructions, including word count, correct chemical selection, and submission format. Important Note Selecting the incorrect chemical based on your last name results in a score of 0. It's crucial to follow this guideline to ensure your work is evaluated. All assignments will be scanned through Turnitin, which checks your work for originality, AI use, and helps ensure academic integrity. X ↓ + Relaunch to update :See Answer
Q16:In the last few weeks, residents have noticed an increasingly large number of dead fish washed up on to the beach. The area is routinely used for a variety of recreational activities including swimming, surfing, boating, and fishing. The local community is concerned about potential toxins in the water, especially since this could affect their health and the local tourism industry. In an effort to investigate this further, you have been hired to research this issue and present your findings at the next city council meeting. Specifically, council members have asked you to identify the toxin/hazardous chemical present in the water. Once you've identified the responsible agent, they would like to know what specific impact this has on aquatic organisms and why the fish have died. They also want to know how their own health could be impacted. You will be preparing several written materials, along with a presentation that you will deliver to the committee. Note: You do not have to actually present to your city council; this is just the scenario for this assignment. Project Objectives You will need to communicate the following knowledge you've gained throughout the course: Describe chemical structures and identify key functional groups. Explain the ways in which molecules interact with each other. Describe the role of eukaryotic organelles and how they relate to the overall functioning of the organism. Explain how energy is stored and utilized by cells. Describe the role of enzymes and inhibitors in controlling metabolic reactions. To accomplish this, you should: Identify and investigate one toxic chemical that can result in the fish deaths that are being observed. Include the chemical structure of the toxin, and identify specific functional groups that may be involved in its mode of action. Explain where this chemical typically comes from and/or is used. Hypothesize about how the chemical is likely entering the organism and/or cells. Identify the specific impact that the identified chemical has on organisms, specifically fish and humans. Identify the specific organs and/or tissues impacted by the toxin. Identify the cellular location/organelle that is impacted. Identify and characterize the metabolic process that is specifically impaired. This should include the identification of an enzyme or potential binding site/target that the toxin is interacting with. Provide reasonable explanations for what might have caused this problem. Please provide citationsSee Answer
Q17:/n Pharmacology & Therapeutics 187 (2018) 71-87 Contents lists available at ScienceDirect Pharmacology & Therapeutics ELSEVIER Associate editor: S. Kimura-S journal homepage: www.elsevier.com/locate/pharmthera Modulation of CYP1A1 metabolism: From adverse health effects to chemoprevention and therapeutic options * Melina Mescher, Thomas Haarmann-Stemmann IUF-Leibniz-Research Institute for Environmental Medicine, 40225 Düsseldorf, Germany Pharmacology Therapeutics Check for updates ARTICLE INFO Available online 17 February 2018 Keywords: Aryl hydrocarbon receptor Chemoprevention Cancer therapy Cytochrome P450 Polycyclic aromatic hydrocarbons Tumor promotion ABSTRACT The human cytochrome P450 (CYP) 1A1 gene encodes a monooxygenase that metabolizes multiple exogenous and endogenous substrates. CYP1A1 has become infamous for its oxidative metabolism of benzo[a]pyrene and re- lated polycyclic aromatic hydrocarbons, converting these chemicals into very potent human carcinogens. CYP1A1 expression is mainly controlled by the aryl hydrocarbon receptor (AHR), a transcription factor whose activation is induced by binding of persistent organic pollutants, including polycyclic aromatic hydrocarbons and dioxins. Ac- cordingly, induction of CYP1A1 expression and activity serves as a biomarker of AHR activation and associated xe- nobiotic metabolism as well as toxicity in diverse animal species and humans. Determination of CYP1A1 activity is integrated into modern toxicological concepts and testing guidelines, emphasizing the tremendous importance of this enzyme for risk assessment and regulation of chemicals. Further, CYP1A1 serves as a molecular target for che- moprevention of chemical carcinogenesis, although present literature is controversial on whether its inhibition or induction exerts beneficial effects. Regarding therapeutic applications, first anti-cancer prodrugs are available, which require a metabolic activation by CYP1A1, and thus enable a specific elimination of CYP1A1-positive tumors. However, the application range of these drugs may be limited due to the frequently observed downregulation of CYP1A1 in various human cancers, probably leading to a reduced metabolism of endogenous AHR ligands and a sustained activation of AHR and associated tumor-promoting responses. We here summarize the current knowl- edge on CYP1A1 as a key player in the metabolism of exogenous and endogenous substrates and as a promising target molecule for prevention and treatment of human malignancies. © 2018 Elsevier Inc. All rights reserved. 1. Introduction The xenobiotic-metabolizing monooxygenase cytochrome P450 (CYP) 1A1 is widely regarded as the prototype target of the aryl Abbreviations: AFB, aflatoxin B1; AH, aryl hydroxylase; AHR, aryl hydrocarbon receptor; AHRR, aryl hydrocarbon receptor repressor; AOP, adverse outcome pathway; ArA, arachidonic acid; ARNT, aryl hydrocarbon receptor nuclear translocator; BaP, benzo[a]pyrene; COX, cyclooxygenase; CYP, cytochrome P450; DMBA, 7,12-dimethylbenz[a]anthracene; EGFR, epidermal growth factor receptor; ER, estrogen receptor; FICZ, 6-formylindolo[3,2-b]carbazole; GST, glutathione S- transferase; HETE, hydroxyeicosatetraenoic acid; 13C, indole-3-carbinol; IDO, indoleamine-2,3-dioxygenase; miRNA and miR, microRNA; NQ01, NAD(P)H:quinone oxidoreductase 1; NRF2, nuclear factor erythroid 2-related factor 2; PAH, polycyclic ar- omatic hydrocarbon; PCB, polychlorinated biphenyl; PPAR, peroxisome proliferator- activated receptor; PUFA, polyunsaturated fatty acid; ROS, reactive oxygen species; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; TDO, tryptophan-2,3-dioxygenase; 3'UTR, 3'-untranslated region; XRE, xenobiotic-responsive element. Corresponding author. E-mail address: Thomas.haarmann-stemmann@IUF-duesseldorf.de (T. Haarmann-Stemmann). hydrocarbon receptor (AHR), also known as the dioxin receptor, and therefore commonly associated with the toxicity and carcinogenicity of dioxins, dioxin-like compounds (dibenzofurans, non-ortho poly- chlorinated biphenyls (PCBs)) and polycyclic aromatic hydrocarbons (PAHs) (Whitlock, 1999). Accordingly, induction of its transcription and enzyme activity has served as a sensitive indicator of AHR activation to screen a variety of compounds, mixtures and environmental matrices (Behnisch, Hosoe, & Sakai, 2001; Hahn, 2002). Moreover, CYP1A1 levels have served as biomarker for environmental and occupational exposure towards PAHs and organochlorines (Cosma, Toniolo, Currie, Pasternack, & Garte, 1992; Lagueux, Pereg, Ayotte, Dewailly, & Poirier, 1999; Lucier, Sunahara, & Wong, 1990; Tang et al., 2008; Vanden Heuvel et al., 1993). Despite of both, the large interindividual variability in its constitutive and inducible expression and the identification of AHR-independent pathways regulating its expression (Delescluse, Lemaire, de Sousa, & Rahmani, 2000; Hu, Sorrentino, Denison, Kolaja, & Fielden, 2007; van Duursen, Sanderson, & van den Berg, 2005), an induction of CYP1A1 is still seen synonymous to AHR activation by the vast majority of investi- gators in both academia and industry. Accordingly, the adverse outcome https://doi.org/10.1016/j.pharmthera.2018.02.012 0163-7258/© 2018 Elsevier Inc. All rights reserved. 72 M. Mescher, T. Haarmann-Stemmann / Pharmacology & Therapeutics 187 (2018) 71–87 pathways (AOPs) “AHR activation leading to hepatic steatosis”¹ and "AHR activation leading to embryo toxicity in fish"¹ define the induction of CYP1A1 as a key event. In the AOP "Rodent liver tumor promotion by sustained activation of AHR"¹ CYP1A1 induction serves as a surrogate marker for the key event, i.e. sustained AHR activation. Moreover, as recommended in the “OECD Guideline for the Testing of Chemicals 417 - Toxicokinetics" from 2010,² two draft guidelines describing the use of standardized in vitro models assessing changes in the expression and activity of CYP enzymes, including CYP1A1 and CYP1A2, to enable a better prediction of the toxicokinetics of chemicals in vivo are currently under evaluation by the OECD.³ Thus, knowledge about the capability of chemicals and drugs to modulate the expression and function of CYP1A1 is of tremendous importance for modern risk assessment and regulatory purposes. Besides its significance for toxicological and phar- macological testing, there is an increasing body of evidence depicting CYP1A1 as a pivotal regulator of physiological processes and as a prom- ising target for disease prevention and therapy. In the following, we summarize the current knowledge on the regu- lation of human CYP1A1 expression and discuss CYP1A1's critical role in detoxification and toxification of endogenous substrates and environ- mental chemicals. The suitability of the AHR/CYP1A1 axis as a target for cancer prevention, the use of CYP1A1 substrates for targeted cancer chemotherapy as well as the frequently observed phenomenon of CYP1A1 silencing in response to inflammatory and oncogenic signals are discussed. 2. Drug-metabolizing CYP monooxygenases The oxidation of lipophilic substrates is a central element of mam- malian drug metabolism. Some of the most important enzymes performing the so-called phase I reactions belong to the CYP superfam- ily of heme-containing monooxygenases (Ioannides & Lewis, 2004; Luch, 2005; Nebert, Shi, Galvez-Peralta, Uno, & Dragin, 2013; Nebert, Wikvall, & Miller, 2013). These enzymes catalyze the NADPH- dependent transfer of one oxygen equivalent to a broad range of exogenous and endogenous substrates thereby enhancing their water solubility. The resulting increase in polarity enables the conjugation of the respective metabolites to hydrophilic moieties, such as activated sugar, sulfate or glutathione, by respective phase II enzymes (Ioannides & Lewis, 2004; Luch, 2005; Nebert, Shi, et al., 2013; Nebert, Wikvall, et al., 2013). In mammals, CYP enzymes are bound to mem- branes, in particular the inner mitochondrial membrane and the endo- plasmic reticulum. There are 18 families of CYP enzymes present in mammals, which encode for 57 individual CYPs in the human genome. CYP enzymes carrying >40% homology in their amino acid sequence are classified as family and designated by Arabic numbers (e.g. CYP2). A se- quence homology of >55% further subdivides the members of a family into subfamilies, which is indicated by a capital letter (e.g. CYP2D). The subsequent Arabic number designates the isoenzymes of a subfam- ily (e.g. CYP2D6) (Ioannides & Lewis, 2004; Nebert, Shi, et al., 2013; Nebert, Wikvall, et al., 2013). The expression of several CYP enzymes is regulated by different transcription factors and thus is inducible by numerous endogenous and exogenous compounds. In addition, a vast number of allelic variants of CYP-encoding genes exists, which may affect CYP expression and function. A respective overview is given on the website of the Human Cytochrome P450 Allele Nomenclature Committee (Sim & Ingelman- Sundberg, 2006). Along with the CYP2 and CYP3 families, CYP1 family enzymes are mainly responsible for the oxidative metabolism of xenobiotic 2 1 www.aopwiki.org, AOPS 21, 41 and 57, last accessed in November 2017 www.oecd-ilibrary.org/environment/test-no-417-toxicokinetics_9789264070882- en, last accessed in November 2017 3 www.oecd.org/env/ehs/testing/section4-health-effects.htm, last accessed in November 2017 compounds. The CYP1 family consists of the three isoenzymes CYP1A1, CYP1A2 and CYP1B1 (Nebert, Dalton, Okey, & Gonzalez, 2004). Whereas basal expression of CYP1A2 is restricted to the liver, it is inducible in the brain, the gastrointestinal tract and hepatic tissue (Nebert et al., 2004). By contrast, CYP1A1 and CYP1B1 are both extrahepatically expressed and inducible (Nebert et al., 2004). The spec- trum of exogenous substrates for CYP1 isoenzymes includes but is not limited to PAHs, heterocyclic amines, aflatoxins, caffeine and pharma- ceutical drugs, such as acetaminophen (paracetamol), granisetron, clo- zapine and R-warfarin (Brown, Reisfeld, & Mayeno, 2008). In addition, CYP1 isoenzymes metabolize several endogenous substances, for in- stance melatonin, steroid hormones and polyunsaturated fatty acids (PUFAs) (Brown et al., 2008; Nebert et al., 2004). 3. Regulation of human CYP1A1 expression 3.1. Transcriptional regulation of CYP1A1 The human CYP1A locus is located on chromosome 15q22 (Jaiswal, Nebert, McBride, & Gonzalez, 1987). The CYP1A1 and CYP1A2 genes consist of 7 exons encoding proteins of 512 amino acids and 516 amino acids, respectively. The two CYP1A genes are arranged in head- to-head orientation with a DNA spacer of about 23 kb in between. This spacer region contains common regulatory elements, including a cluster of up to 15 xenobiotic-responsive elements (XRE) (Corchero, Pimprale, Kimura, & Gonzalez, 2001; Jorge-Nebert et al., 2010; Kress, Reichert, & Schwarz, 1998; Nukaya & Bradfield, 2009; Nukaya, Moran, & Bradfield, 2009; Ueda et al., 2006), emphasizing the pivotal role of the AHR in CYP1A gene regulation (Fig. 1). The AHR is a ligand-activated transcription factor belonging to the basic-Helix-Loop-Helix/Per-ARNT-Sim protein superfamily, whose members regulate gene expression in response to environmental and physiological signals (Bersten, Sullivan, Peet, & Whitelaw, 2013). Origi- nally discovered as a key regulator of xenobiotic metabolism that trig- gers the toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related environmental pollutants, there is now ample evidence that the AHR is an important regulator of numerous physiological as well as pathophysiological processes (Abel & Haarmann-Stemmann, 2010; Bersten et al., 2013; Denison, Soshilov, He, DeGroot, & Zhao, 2011; Esser & Rannug, 2015; Murray, Patterson, & Perdew, 2014). In its inactive state, the AHR rests in a cytosolic multiprotein com- plex consisting of two heatshock protein 90 molecules, the AHR- interacting protein and the co-chaperone p23 (Abel & Haarmann- Stemmann, 2010; Bersten et al., 2013; Denison et al., 2011). Upon ligand-binding, the AHR undergoes conformational changes initiating the dissociation of the multiprotein complex and the exposure of a nuclear localization sequence. Subsequently, the AHR translocates into the nucleus and dimerizes with its partner molecule AHR nuclear translocator (ARNT). The AHR/ARNT complex binds to XRES (5'- GCGTG-3') in the enhancer region of target genes, such as CYP1A1, and sequentially recruits transcriptional co-activators and RNA poly- merase II to induce their transcription (Fig. 1) (Abel & Haarmann- Stemmann, 2010; Bersten et al., 2013; Denison et al., 2011). The AHR gene battery encodes for CYP1 isoenzymes and various other drug- metabolizing enzymes, such as NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST) A2, aldehyde dehydrogenase 3A1 and family 1 UDP-glucuronosyltransferases. In addition, the AHR gene battery encodes for proteins controlling cell division, differentia- tion and apoptosis (e.g. Bax, c-jun, c-myc, Hes-1, IL-2, junD, p21CIP1 and p27KIP1) as well as for a negative feedback inhibitor of AHR signal- ing, the AHR repressor (AHRR) (Bock & Köhle, 2006). Depending on cell-type and tissue, the AHRR may compete with AHR for both ARNT- and XRE-binding thereby attenuating the AHR-driven expression of CYP1A1 and other target genes (Vogel & Haarmann-Stemmann, 2017). AHR ligands include ubiquitous environmental pollutants, such as PAHs, dibenzo-p-dioxins, dibenzofurans and dioxin-like PCBs, as HSP90 00 00 AHR HSP90 p23 AIP p23 AIP D AHR AHR ARNT XRE M. Mescher, T. Haarmann-Stemmann / Pharmacology & Therapeutics 187 (2018) 71-87 ARNT AHRR CYP1A1 CYP1B1 ... Fig. 1. Regulation of CYP1A1 expression through the AHR signaling pathway. In its inactive state, the AHR rests in a cytosolic multiprotein complex. Upon ligand-binding, this complex dissociates and the AHR shuttles into the nucleus and heterodimerizes with ARNT. The AHR/ARNT complex binds to XRES in the enhancer region of target genes, for instance encoding CYP1A1 and AHRR, to induce their transcription. well as plant- and bacteria-derived polyphenols and indoles (Abel & Haarmann-Stemmann, 2010; Denison et al., 2011; Hubbard et al., 2015; Murray et al., 2014; Stejskalova, Dvorak, & Pavek, 2011). In addi- tion, various endogenous compounds have been identified to serve as AHR agonists, including tryptophan metabolites, such as kynurenine, kynurenic acid and xanthurenic acid, indole derivatives, such as 6- formylindolo[3,2-b] carbazole (FICZ), and arachidonic acid (ArA) me- tabolites, such as lipoxin A4 (Abel & Haarmann-Stemmann, 2010; Denison et al., 2011; Murray et al., 2014; Stejskalova et al., 2011). Notably, remarkable species-specific differences in the AHR ligand spectrum and affinity exist, which have to be carefully considered for regulatory purposes, for instance when data from animal studies are being extrapolated to define human threshold values. A good example for chemicals exhibiting species-specific differences in AHR binding af- finity are PCBs: Whereas several dioxin-like PCBs activate the rat AHR, PCB 126 seems to be the only congener that is capable of stimulating human AHR activity (Larsson et al., 2015). In addition, comparisons of inducible CYP1A enzyme activity and XRE-driven reporter gene activity in rat and human hepatic cells have shown that PCB 126 as well as TCDD is dramatically less affine to the human than to the rat AHR protein (Brennan et al., 2015; Larsson et al., 2015; Silkworth et al., 2005). Besides the canonical AHR/ARNT pathway, the ligand-activated AHR frequently interacts with other major cellular signaling pathways, in- cluding epidermal growth factor receptor (EGFR), hypoxia-inducible factor, Wnt/ẞ-catenin, nuclear factor erythroid 2-related factor 2 (NRF2) and NF-κB signaling, which also may have an impact on 73 CYP1A1 expression (Abel & Haarmann-Stemmann, 2010; Denison et al., 2011; Haarmann-Stemmann & Abel, 2012; Ma, Kinneer, Bi, Chan, & Kan, 2004; Schulthess et al., 2015). In addition to the XRE cluster, several binding sites for other tran- scription factors, including peroxisome proliferator-activated receptor (PPAR)-a, constitutive androstane receptor and p53, have been identi- fied in the regulatory sequence of the human CYP1A loci (Table 1), which may modulate CYP1A1 expression in a cell-, tissue- and develop- mental stage-specific manner in response to various physiological and pathophysiological signals. 3.2. Post-transcriptional regulation of CYP1A1 by microRNAs MicroRNAs (miRNAs) are conserved small non-coding RNAs of ~23 nucleotides that resemble the RNA-silencing function of small- interfering RNAs. They assemble with Argonaute proteins and form miRNA-induced silencing complexes to interact with complementary mRNAs, preferentially in the 3'-untranslated region (3'UTR), to induce their degradation and inhibit their translation (He & Hannon, 2004). By using different online prediction tools, several studies have identified miRNAs that may target the human CYP1A1 mRNA. However, probably due to their extremely variable expression pattern, the identified miRNAs do not overlap. For instance, one study has identified one or more putative binding sites for miR-125b-2, miR-488, miR-511, miR- 626, miR-657 and miR-892a in the 3'UTR of the human CYP1A1 tran- script (Jorge-Nebert et al., 2010). Another study found a correlation between the expression of miR-21, miR-34a, miR-132, miR-132-3p, miR-148b, miR-200a and miR-200b and a reduced CYP1A1 protein level (Rieger, Klein, Winter, & Zanger, 2013). In addition, miR-21-3p, miR-125b-5p, miR-150 and miR-892a were shown to repress CYP1A1 in human tissues and cells (Burgess et al., 2015; Choi et al., 2012; Lo et al., 2017; Sturchio et al., 2014). Finally, an in silico approach using five different prediction platforms identified 2, 85, 264 and two- times 14 unique miRNAs targeting the human CYP1A1 mRNA (Ramamoorthy & Skaar, 2011), illustrating a huge grade of diversity and uncertainty in miRNA prediction. Taken together, these findings indicate that CYP1A1 is post- transcriptionally regulated by miRNAs. Due to the limited experimental evidence, it is hardly predictable to which extent miRNAs influence the activity and function of CYP1A1. The correlation of miRNA expression patterns with a reduced expression of CYP1A1 is probably also compro- mised by miRNAs that target AHR or ARNT and thus indirectly abrogate CYP1A1 expression. Interestingly, several single nucleotide polymor- phisms in the CYP1A1 gene have been described to delete or create po- tential binding sites for miRNAs in the 3'UTR of the respective mRNA molecule (Jorge-Nebert et al., 2010; Ramamoorthy & Skaar, 2011). Table 1 Transcription factors having one or more binding-sites in the human CYP1A1 promoter/ enhancer. Transcription factor Aryl hydrocarbon receptor Basic transcription element binding protein 3 Basic transcription element binding protein 4 Constitutive androstane receptor Liver X receptor alpha Nuclear factor-I p53 Reference Prototype ligand TCDD / Kress et al. (1998) Kaczynski et al. (2002) Phenobarbital Oxysterols Peroxisome proliferator-activated Arachidonic acid receptor alpha Retinoic acid receptor alpha Thyroid hormone receptor alpha Vitamin D receptor 9-cis-Retinoic acid Triiodothyroine Calcitrol Kaczynski et al. (2002) Yoshinari, Yoda, Toriyabe, and Yamazoe (2010) Shibahara et al. (2011) Morel and Barouki (1998) Wohak et al. (2016) Seree et al. (2004) Vecchini et al. (1994) Vecchini et al. (1994) Matsunawa et al. (2012) 74 4. Metabolic control of AHR signaling M. Mescher, T. Haarmann-Stemmann / Pharmacology & Therapeutics 187 (2018) 71-87 Except metabolically stable ligands, such as TCDD, xenobiotics that enter the cell and activate AHR induce their own oxidative metabolism via CYP1 isoenzymes. Transient transfection experiments with CYP1A1, CYP1A2 and CYP1B1 constructs have shown that overexpression of the CYP1 enzymes reduced the basal activity of a XRE-driven reporter gene, indicating the presence of endogenous AHR agonists (Chiaro, Patel, Marcus, & Perdew, 2007). A possible candidate is FICZ (Rannug et al., 1987), which is intracellularly generated upon absorption of ultraviolet-B radiation by tryptophan (Fritsche et al., 2007) or through the oxidation of tryptophan or indole-3-pyruvate by hydrogen peroxide (Smirnova et al., 2016; Wincent et al., 2012), and known to be rapidly metabolized by CYP1A1 (Bergander et al., 2004). Accordingly, it was shown that inhibition of CYP1A1 enzyme activity elevates intracellular FICZ levels and associated AHR activity (Wincent et al., 2012, 2016). Vice versa, general as well as intestine-directed overexpression of CYP1A1 in mice resulted in an accelerated clearance of endogenous as well as food-derived AHR ligands, leading to the termination of AHR sig- naling and associated adverse health effects in the intestine, i.e. loss of certain immune cell populations and elevated susceptibility to enteric infection (Schiering et al., 2017). Just recently, CYP1A1 inhibition was reported to simultaneously increase the expression of c-kit and IL-22 and decrease the expression of IL-17 in human primary CD4+ T helper cells. Co-treatment with the ligand-selective AHR antagonist CH-223191 reversed these effects, indicating that the CYP1A1-driven metabolism of endogenous AHR ligands critically influences AHR- dependent immune reactions (Effner et al., 2017). 5. Substrates of CYP1A1 As recently described in more detail (Santes-Palacios et al., 2016; Sridhar, Goyal, Liu, & Foroozesh, 2017), the human CYP1A1 protein con- sists of four ẞ-sheets and 12 α-helices harboring the catalytically active site with the heme iron center. The structure of the human CYP1A1 en- zyme allows the binding of planar aromatic or heterocyclic molecules with a dimension of approximately ~12.3 Å × ~4.6 Å (Santes-Palacios et al., 2016). The catalytic cycle starts with a substrate binding near to the catalytic center resulting in the displacement of a loosely bound water molecule. Subsequently, the CYP reductase transfers an electron from NADPH to the iron atom leading to the association of molecular ox- ygen. The transmission of a second electron and the admission of two protons lead to cleavage of the molecular oxygen. Subsequently, one ox- ygen atom is integrated into a water molecule, whereas the other one is transmitted to the substrate. Finally, water displaces the oxidized sub- strate, thereby restoring the resting state (Santes-Palacios et al., 2016; Sridhar et al., 2017). The major catalytic reactions carried out by CYP1A1 are oxidation reactions, such as hydroxylation, epoxidation, N-hydroxylation and O-demethylation, as well as nitroreductions (Santes-Palacios et al., 2016; Sridhar et al., 2017). The structure of some aromatic and heterocyclic chemicals and their CYP1A1- generated metabolites are shown in Fig. 2. A more complete picture of CYP1A1 substrates is provided in the following review articles (Brown et al., 2008; Nebert et al., 2004; Santes-Palacios et al., 2016). 5.1. CYP1A1 and estrogen metabolism Estrogen levels critically influence cell proliferation, development and tissue homeostasis, and a dysregulation of estrogen/estrogen recep- tor (ER) signaling is associated with the development of cancer, meta- bolic and cardiovascular diseases, osteoporosis and neurodegenerative diseases (Jia, Dahlman-Wright, & Gustafsson, 2015). The oxidative metabolism of 17ẞ-estradiol is driven by several CYP enzymes in hepatic as well as extrahepatic tissues. The quantitatively dominating metabolites of 17ẞ-estradiol are 2-hydroxyestradiol and 4-hydroxyestradiol (Jefcoate et al., 2000; Tsuchiya, Nakajima, & Yokoi, 2005). The hydroxylation at position 2 is carried out by CYP1A1 (Fig. 2), CYP1A2 and CYP3A4 (Lee, Cai, Thomas, Conney, & Zhu, 2003) and is, at least in the context of carcinogenicity, regarded as a detoxifica- tion process (Tsuchiya et al., 2005). Even though, 2-hydroxyestradiol may undergo redox cycling, it is rapidly methylated by the catechol O-methyltransferase to 2-methoxyestradiol, a process that also neutralizes the mitogenic potential of 17ẞ-estradiol. Accordingly, 2- hydroxyestradiol is not carcinogenic in animal models. In contrast, the 4-hydroxylation of 17ẞ-estradiol is carried out by CYP1B1 (Hayes et al., 1996), which is highly expressed in estrogen target tis- sues (Jefcoate et al., 2000; Tsuchiya et al., 2005). 4-hydroxyestradiol is a potent redox-cycler, whose detoxification by the catechol O- methyltransferase occurs much slower as compared to 2- hydroxyestradiol. The resulting generation of reactive oxygen species (ROS) and the associated oxidative damage of DNA, along with the mitogenic action of estradiol, may contribute to the development of hormone-dependent malignancies, such as endometrial and breast cancer (Jefcoate et al., 2000; Tsuchiya et al., 2005). The CYP1A1-mediated metabolic breakdown of estrogens may contribute to the anti-estrogenic effects associated with an exposure to several environmental as well as natural AHR ligands. In fact, the anti-estrogenicity of TCDD, PCBs and structurally related persistent organic pollutants has been assigned, at least in part, to an AHR- dependent induction of CYP1A1 and CYP1B1 activities (Hayes et al., 1996; Segura-Aguilar, Castro, & Bergman, 1997; Spink et al., 1992; Spink, Lincoln, Dickerman, & Gierthy, 1990). In addition, PAHs found in tobacco smoke (Michnovicz, Hershcopf, Naganuma, Bradlow, & Fishman, 1986) as well as dietary derived compounds, such as indole-3-carbinol (I3C) and its acidic condensation product indolo [3,2-b]carbazole (Liu, Wormke, Safe, & Bjeldanes, 1994; Yuan et al., 1999), may enhance the CYP1A1-mediated oxidation of 17ẞ-estradiol to 2-hydroxyestradiol. An enforcement of steroid hormone metabolism by CYP1A1 should not only be seen in the light of endocrine disruption, as it may be of interest for the therapy of hormone-dependent cancers as well. In fact, I3C has been successfully investigated in a phase I clinical trial for its capability to enhance estrogen detoxification in a cohort of high-risk breast cancer women (Reed et al., 2005). Notably, additional CYP1-independent mechanisms have been de- scribed by which AHR modulators may manipulate endocrine systems and vice versa (Monostory, Pascussi, Kobori, & Dvorak, 2009). For instance, AHR activation may enforce the proteasomal degradation of ERQ and other steroid hormone receptors (Ohtake et al., 2007; Wormke et al., 2003) and dysregulate the expression of CYP19 aroma- tase, a key enzyme in estrogen synthesis (Baba et al., 2005). 5.2. CYP1A1 and arachidonic acid metabolism Beside steroid hormones, CYP1A1 is also critically involved in the metabolism of endogenous PUFAs, in particular arachidonic acid (ArA) and eicosanoids (Hankinson, 2016; Nebert et al., 2004; Nebert, Shi, et al., 2013; Nebert, Wikvall, et al., 2013). ArA is a 0-6 PUFA present in the phospholipids of cell membranes, which triggers inflammatory re- actions, cellular signaling and vasodilation. Phospholipases are capable of releasing ArA from the cell membranes thereby making it accessible for various oxidases. Specifically, ArA is metabolized by cyclooxygenase (COX)-1 and COX-2, arachidonate 5-, 12- and 15-lipoxygenase as well as by several CYP enzymes to a wide range of biologically active eicosa- noids, including prostacyclins, prostaglandins (PG), thromboxanes, leukotriens, epoxyeicosatrienoic acids and hydroxyeicosatetraenoic acids (HETE) (Funk, 2001; Soberman & Christmas, 2003). Eicosanoids are local hormones produced by vertebrate cells, which act in an auto- crine and/or paracrine manner. These straight-chain PUFAs act through G-protein coupled cell surface receptors, so-called prostanoid receptors, as well as nuclear receptors, in particular PPARs (Grygiel-Gorniak, 2014; Luo, Flamand, & Brock, 2006). Eicosanoids are involved in the regulation of pro-inflammatory responses, fever, pain, blood clotting, blood M. Mescher, T. Haarmann-Stemmann / Pharmacology & Therapeutics 187 (2018) 71-87 O-deethylation CH3 7-ethoxyresorufin benzo[a]pyrene N CH3 ΝΗ -NH2 2-amino-1-methyl-6-phenyl- Imidazo[4,5-b]pyridine HN epoxidation N-hydroxylation NH hydroxylation 6-formylindolo[3,2-b]carbazole H3C NH melatonin HN CH3 OH resorufin benzo[a]pyrene-7,8-epoxide CH3 OH NH NH 2-hydroxyamino-1 methyl-6-phenyl- imidazo[4,5-b]pyridine HN H NH OH 2-hydroxyindolo[3,2-b]carbazole- 6-carboxaldehyde hydroxylation H3C hydroxylation OH CH3 но NH CH3 HN 6-hydroxymelatonin OH OH CH3 75 arachidonic acid 19-hydroxy-arachidonic acid Fig. 2. Typical substrates, reactions and metabolites of CYP1A1. This figure presents an overview on different exogenous and endogenous substrates of CYP1A1 and the corresponding types of reaction and metabolites. pressure and allergic reactions (Funk, 2001; Soberman & Christmas, 2003). In addition, several eicosanoids, in particular PGE2 (Nakanishi & Rosenberg, 2013; Pang, Hurst, & Argyle, 2016) but also 12-HETE and 20-HETE (Honn et al., 1994; Pidgeon et al., 2007; Wang & DuBois, 2010), have been identified to promote cancer growth by interacting with different signal transduction pathways. For instance, 12-HETE was shown to activate protein kinase C and MAPK signaling pathways thereby altering cancer cell proliferation, motility and apoptosis suscep- tibility (Ding, Tong, & Adrian, 2001; Szekeres, Tang, Trikha, & Honn, 2000). The laboratory of Oliver Hankinson has recently performed a liquid chromatography-tandem mass spectrometry-based analysis of a large number of PUFA metabolites in tissue extracts from TCDD-treated wild-type and AHR-KO mice (Hankinson, 2016; Yang, Solaimani, Dong, Hammock, & Hankinson, 2013). The analysis revealed that TCDD treatment markedly increased the levels of several epoxides and diol metabolites of both -6 and -3 PUFA in the liver and lungs of mice in an AHR- and CYP1-dependent fashion. Another study has shown that in mouse liver microsomes, TCDD-induced CYP1A enzymes increased epoxyeicosatrienoic acid 2-fold, 19-HETE 5-fold and 16- to 18-HETE 20-fold (Lee, Lawrence, Kerkvliet, & Rifkind, 1998). Human CYP1A1 acts primarily as an ArA hydroxylase, which oxidizes ArA to 19-OH-ArA (90%) (Fig. 2) and 14,15-epoxyeicosatrienoic acids (7%) (Schwarz et al., 2004). With eicosapentaenoic acid as substrate, human CYP1A1 behaves as epoxygenase producing 17,18- epoxyeicosatrienoic acids (68%) and to a lesser extent 19-OH- eicosapentaenoic acid (31%) (Schwarz et al., 2004). In addition, in vitro studies revealed that human CYP1A1 is also capable of oxidizing ArA to HETE. Specifically, the production of 12-HETE and several C-terminal HETE (16- to 20-HETE) was shown to depend on the cata- lytic activity of CYP1A1 (Choudhary, Jansson, Stoilov, Sarfarazi, & Schenkman, 2004; Jarrar et al., 2013; Nguyen et al., 2016). Interestingly, studies on TCDD-exposed chick embryo livers revealed an induction of CYP1A4, the avian ortholog of mammalian CYP1A1, and subsequent epoxygenation of ArA not only in microsomes but also in mitochondria (Labitzke, Diani-Moore, & Rifkind, 2007).See Answer
Q18:Benefits of molecular imaging of liver cancer with [18F]FDG PET in modern healthcare - a review from radiolabeling to clinical useSee Answer

Student Stories

Tutorbin has got more than 3k positive ratings from our users around the world. Some of the students and teachers were greatly helped by the TutorBin.

"After using their service, I decided to return back to them whenever I need their assistance. They will never disappoint you and craft the perfect homework for you after carrying out extensive research. Whether you need Pharmaceutical Science assignment help or support in other subjects, their expertise will surely amp up your performance, and you will soon outperform your peers."

Olivia

"Ever since I started using TutorBin, life became easier. Whether it’s homework help pharmaceutical science or other subjects, they deliver quality work on time. My grades improved significantly with their support."

Gloria

“They are amazing. I sought their Pharmaceutical Science homework help, and the answers they provided were unique and completely original. They truly helped me get into my professor’s good books. I highly recommend their service.”

Michael

"The service they provide is great. Their answers are unique, and expert professionals with a minimum of 5 years of experience work on the assignments. Whether you need Pharmaceutical Science help or support in other subjects, expect the answers to be of the highest quality and get ready to see your grades soar."

Richard

"They provide excellent assistance. What I loved the most about them is their homework help. They are available around the clock and work until you derive complete satisfaction. If you need Pharmaceutical Science homework answers, their experts ensure accuracy and quality. If you decide to use their service, expect a positive disconfirmation of expectations."

Willow

TutorBin helping students around the globe

TutorBin believes that distance should never be a barrier to learning. Over 500000+ orders and 100000+ happy customers explain TutorBin has become the name that keeps learning fun in the UK, USA, Canada, Australia, Singapore, and UAE.