biotechnology homework help

Boost your journey with 24/7 access to skilled experts, offering unmatched biotechnology homework help

Trusted by 1.1 M+ Happy Students

4.4Trust Pilot

4.4Edu Reviewer

5App Review

4.8Student

4.2Sitejabber

Recently Asked biotechnology Questions

Expert help when you need it

Q1:2. Given the below DNA sequence and the given Forward primer sequence (highlighted in yellow), design the reverse primer sequence (of a 20bp length) that you would have to purchase if you want to generate a 876bp amplicon. GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTG CTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCC AGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTG ATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGG GGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCA CACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTG CCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGG GGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGAC TGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGA CAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGT GTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGA CAGGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGG TCCTGGGGATAGGGGSee Answer
Q2:In this lab you will first simulate the preparation of a PCR which will be carried out to amplify a fragment of a gene which may contain the causative SNP. The PCR products will then be digested with an enzyme to discover whether the 'normal type' or 'disease type' of the allele is present in your samples. The samples will then be analysed by gel electrophoresis.See Answer
Q3:INSTRUCTIONS Need to do the question given below With the aid of a hand-drawn diagram, explain the procedure which generates size- based photographic representation of chromosomes.See Answer
Q4:Come up with two ideas for starting a biotech company Your task is to come up with two ideas for starting a biotechnology company that uses CRISPR-Cas or another technology to produce something that will sell. You can choose to modify any gene in any species except humans. In humans you can only modify blood cells. 14% of each student's grade will be from the Long-Term Project (LTP), except for students that choose to opt out. You should browse the internet looking for ideas. You should consider the competitive nature of commercialization and choose a gene to edit that could make a whole lot of money. I used to recommend Googling as well as searches on Google Scholar and Pubmed. However, I have found that using Google is so effective that Google Scholar and Pubmed searches are rarely needed. Your task will be to submit two gene ideas in 400 words in the following format: (1) Explain the problem, need, or expected demand (2) Explain what the gene does and the species of organism you want to modify (3) Explain what you want to do with the gene (4) Explain why this would sell (5) Explain why this is doable Feel free to run your idea by me. I will give you feedback on whether the idea is realistic or not and original/innovative or not. If it isn't realistic you will be asked to find another gene.See Answer
Q5: Exercise 4 (continued) GENE EXPRESSION Introduction: Expression systems are designed to produce many copies of a desired protein within a host cell. In order to accomplish this, an expression vector is inserted into a host cell. This vector contains all of the genetic coding necessary to produce the protein, including a promoter appropriate to the host cell, a sequence which terminates transcription, and a sequence which codes for ribosome binding. One expression system was developed in 1986 by W. F. Studier and B. A. Moffatt, who created an RNA polymerase expression system which was highly selective for bacteriophage T7 RNA polymerase. This expression system is commonly known as the T7 expression system. The pET series of vectors have been developed for cloning and expression of recombinant proteins using the T7 system. These plasmids contain a T7 promoter which is specific to only T7 RNA polymerase (not bacterial RNA polymerase), a polylinker to clone in DNA, an antibiotic resistance gene, and a ColE1 origin of replication. The pET-44 vectors are designed for cloning and expression of peptide sequences fused with the Nus protein which has great solubility potential (recall the importance of correct folding). This vector encodes a Nus protein with a N-terminal His-tag to facilitate purification by metal chelate chromatography. Attached is a map for the pET-44 vector series. Without insertion of foreign DNA, the recombinant Nus protein expressed from pET-44 is ~68 kD. As indicated above, the T7 expression system depends on the regulated expression of T7 RNA polymerase, an extremely active enzyme that is encoded in the DNA of bacteriophage T7. The T7 RNA polymerase transcribes DNA beginning within a specific 23-bp promoter sequence called the T7 promoter. Copies of the T7 promoter are located at several sites on the T7 genome, but none is present in E. coli chromosomal DNA. In this expression system, recombinant E. coli cells have been engineered to carry the gene encoding T7 RNA polymerase next to the lac promoter. Typically, the host cell used is E. coli strain BL21(DE3). These cells then are transformed with plasmid vectors that carry a copy of the T7 promoter and, adjacent to it, the DNA encoding the desired protein (see Figure below). When lactose or a molecule similar to lactose, such as IPTG (isopropyl-ẞ-D-thiogalactopyranoside), is added to the culture medium containing these transformed, recombinant E. coli cells, T7 RNA polymerase is expressed by transcription from the lac promoter. The polymerase then binds to the T7 promoter on the plasmid expression vectors, catalyzing transcription of the inserted DNA at a high rate. Since each E. coli cell contains many copies of the expression vector, large amounts of mRNA corresponding to the cloned DNA can be produced in this system. Typically, 10 – 50 percent of the total protein synthesized by these cells after addition of IPTG is the protein of interest. Very high levels of Nus protein lac promoter Multiple T7 RNA polymerases T7 RNA Nus DNA polymerase gene T7 late promoter PET44 Recombinant E. coli chromosome Plasmid expression vector Figure – T7 Expression System - E. coli BL21(DE3) containing pET-44. 41 DAY 1 (REVIEW) Transformation into Expression Host BL21(DE3) For transforming into the expression host BL21(DE3), use 1-2 µl of the pET-44 plasmid (50 ng/μl) and follow your transformation procedure. After the heat shock and dilution, spread cells on LB and LB-Amp plates and incubate overnight at 37°C. Using 100 ng of pET-44 with the competent BL21(DE3) cells, approximately 500 colonies should be obtained per plate with your transformation procedure. Setting up for Option 3 below: Hint: Put this in your notebook. It is Ok to do this at home. You will be provided an ampicillin stock of 100 mg per ml. Write out the calculations for 5 ml LB containing 100 µg per ml of ampicillin, 50 ml of LB containing 100 µg per ml of ampicillin in an Erlenmeyer flask in your notebook. Make these solutions and store them in the refrigerator. DAY 2 Growth and induction: The following protocol is a “suggested/general" protocol. We will modify the protocol as needed; based on how the labs proceed. Write out the protocol that you actually use in your lab notebook. Make sure you save samples at each stage of the purification protocol. You will run all these samples on a gel. IT IS IMPERATIVE THAT YOU SAVE SAMPLES AT EACH STEP TO RUN ON AN SDS GEL. OPTIONS: We will use Option 3: 1) Pick a single colony from the plate of transformed cells and inoculate into 50 ml LB containing 100 μg per ml of ampicillin in a 250 ml Erlenmeyer flask. 2) Alternatively, streak a LB-Amp plate from a glycerol stock of BL21(DE3) cells containing pET-44, incubate overnight at 37°C, and inoculate a single colony into LB media containing ampicillin as above. 3) We will use this method: Pick a single colony from the plate of transformed cells and inoculate into 5 ml LB containing 100 µg per ml of ampicillin, incubate overnight at 37°C. Use this culture to inoculate 50 ml of LB containing 100 µg per ml of ampicillin in an Erlenmeyer flask. a) Pick a single colony from the plate of transformed cells and inoculate into 5 ml LB containing 100 µg per ml of ampicillin, incubate overnight at 37°C. (This will be performed by the lab technician). Transfer the 5ml of culture to the 50 ml flask. Incubate with shaking (100-150 rpm, depends on flask size) at 37°C until OD 600 reaches 0.5-0.7 (about 3-4 hours). (Sample size for O.D reading: 4 ml). Remove ~1.0 ml sample for the uninduced control, centrifuge, and store cell pellet at 0 to - 20°C. You may take the 1 ml from the 4 ml sample you removed for the OD reading. An alternate procedure (which we will not use in this class) place flask in 37°C oven (stationary) overnight and shake the following morning until the appropriate OD 600 is obtained. b) Chill the cells on ice for 15-30 minutes. c) Add IPTG to a final concentration of 0.2mM (100µl of 100mM IPTG (provided) per 50ml of culture). 42 d) Continue shaking at overnight at room temperature at 100 rpm. An alternate procedure (which we will not use in this class) is to shake the cells at 100 rpm@ 37°C for 3-4 hr. Efficient IPTG induction results in reduction of cell growth. Post-induced cultures are typically less than 2X the initial cell density. (Record OD600) e) Following induction, remove ~1.0 ml sample, centrifuge, and store pellet at 0 to -20°C for analysis of total cell protein. You may take the 1 ml from the 4 ml sample you removed for the OD reading. f) Place the flask of the post-induced culture on ice for 10 min or store the cells in the refrigerator. Harvest the cells by centrifugation at 5000xg for 5-10 min at 4°C. Resuspend the cells in 1-1.5 ml of 50mM Tris-Cl (pH 8.0), transfer to eppendorf tube, and centrifuge for ~1 min. Remove the supernatant and store the cells at -20°C or continue with lysis and purification. Protein extraction is typically more effective with frozen cells. DAY 3 Lysis If cells have been stored at -20°C, remove from freezer and thaw at room temperature for 10-15 min. a) For a cell pellet harvested from 40-50 ml of culture, resuspend in 1 ml of Bacterial Lysis Reagent by gently pipetting up and down until the cell suspension is homogenous. Rotate the tube for an additional 10 min at room temperature. Alternatively, invert tube to mix cell suspension every couple min over 10 min. Do not vortex. b) Centrifuge at 12,000 rpm for 8 min to separate soluble and insoluble fractions. The soluble protein is in the supernatant. c) Transfer the supernatant to a clean tube (Soluble Lysate #1). Save for purification. d) Repeat extraction by resuspending the insoluble fraction in 1 ml of Bacterial Lysis Reagent. Gently pipet up and down until suspension is homogeneous. Centrifuge at 12,000 rpm for 8 min e) Transfer the supernatant to a clean tube (Soluble Lysate #2). Save for purification. f) Save 40 μl aliquots of Soluble Lysates #1 and #2 for SDS-PAGE analysis. You will only use 20 ul for the gel on Day 4. This gives you some extra sample in case you need to rerun the gel for any reason. Metal Chelate Affinity Purification Buffers (included) for Metal Chelate Chromatography Binding Buffer: 20mM Tris-Cl (pH 8), 0.5M NaCl, 5mM imidazole Wash Buffer: 20mM Tris-Cl (pH 8), 0.5M NaCl, 20mM imidazole Elution Buffer: 20mM Tris-Cl (pH 8), 0.5M NaCl, 200mM imidazole The metal chelate chromatography columns contain a resin with nickel-nitrilotriacetic acid (Ni-NTA) coupled to cellulose beads. The Ni-NTA matrix binds proteins carrying a stretch of at least six consecutive histidine residues. The Nus protein expressed from pET44 carries such a His-tag sequence to allow affinity purification via the nickel ion bound to the resin matrix. The target protein is recovered by elution with imidazole. 43 The metal chelation chromatography columns are ready to use for rapid purification of His-tagged proteins. Each column is packed with ~0.4 ml of metal chelate resin containing 20% ethanol as preservative. In general, the binding capacity is ~5 mg protein per ml of resin. - 1) In an eppendorf storage rack, place six tubes (12 x 75 mm, included) and three eppendorf tubes (2 ml, included). Label sequentially the 12 x 75 mm tubes – Equilibration, Unbound Soluble Lysate #1, Unbound Soluble Lysate #2, Wash 1, Wash 2, and Wash 3. Label the eppendorf tubes as Elute 1, Elute 2, and Elute 3. 2) Snap off the bottom tip of a column and place in Equilibration tube. Remove top cap and allow the excess packing buffer to drain by gravity to top of gel bed. If column does not begin to flow, push cap back into top of column and remove. If column still does not begin to flow, attach syringe (included) to bottom of column and gently pull out the syringe to start flow. Place column back into tube to drain. 3) Discard drained buffer and place column back into Equilibration tube. Hint: Centrifuge both Soluble Lysate 1 and Soluble Lysate 2 at 12,000 rpm for 8 min (AGAIN). This is to avoid adding any cell debris to the column which will slow the column down. 4) Apply 0.75 ml of Binding Buffer and allow column to drain. Repeat with 0.75 ml of Binding Buffer. 5) Place column into next tube and carefully apply sample from Soluble Lysate #1. Allow sample to fully drain into collection tube. Hint: it is better to leave a little liquid behind than add debris to the column. 6) Remove column, place into next tube, and apply sample from Soluble Lysate #2. Hint: it is better to leave a little liquid behind than add debris to the column 7) After sample has fully drained, remove column and wash three times with 1 ml of Wash Buffer, collecting the flow-through fractions in Wash 1 -3 collection tubes. 8) Following the last wash, place column into first eppendorf tube and elute with 250 μl of Elution Buffer (Remember this would contain your purified product- SAVE IT! Remove 40 ul for gel analysis). 9) Repeat with 400 µl of Elution Buffer, collecting eluate in tube labeled Elute 2 (Remember this would contain your purified product- SAVE IT! Remove 40 ul for gel analysis). 10) Repeat with 400 μl of Elution Buffer, collecting eluate in tube labeled Elute 3 (Remember this would contain your purified product- SAVE IT! Remove 40 ul for gel analysis). DAY 4 SDS-PAGE Analysis Analyze column fractions on 7.5-10% SDS gels. The Nus protein expressed from pET-44 runs at ~68 kD. Some degradation of the purified Nus protein will be observed due to absence of protease inhibitors. Protein assays will not be run for this lab, however if protein assays are performed on elution fractions, load 5-10 ug. Most of the protein eluted from the Ni-NTA column will be in the Elute 2 fraction (1-2 µg/µl). If protein assays are not performed, run ~10µl from Elute 1, 2 and 3. Loading the gel: i. If total cell protein from uninduced and induced cells is also to be analyzed, resuspend cell pellets (1 ml cell cultures) in 80 µl Laemmli buffer and load 20 µl. 44 ii. For the other column fractions being analyzed, Soluble Lysate 1 and Soluble Lysate (15 μl) add 15 µl of Laemmli buffer. Load 30 μl of each sample on the gel. iii. For Elute 1, 2 and 3, take 15 µl samples and add 15 µl Laemmli buffer. Load 30 µl of each sample on the gel. iv. Do not forget to load a Kaleidoscope marker/ladder. It is OK to load marker in two lanes if available. It is sometimes useful to heat all the samples to 95°C for 5 minutes prior to loading. Coomassie Colloidal Blue Staining of SDS gels The Colloidal Blue Staining Reagent uses the colloidal properties of Coomassie G-250 dye for protein staining of polyacrylamide gels. The reagent stains only protein and allows bands to be viewed directly during the staining process. Standard Procedure 1) Following SDS-PAGE, remove gel and place in clean dish. Rinse gel three times with 100 ml of deionized water (5 min incubation each wash). 2) Mix the Colloidal Blue Stain Reagent just before use by gently inverting and swirling the reagent bottle. 3) Discard water wash and add 20-30 ml of the Colloidal Blue Stain Reagent to the gel. Gently shake or periodically agitate. Stain intensity should reach maximum within 2 hr. Gels may be stained overnight without increasing background. 4) If desired, destain with 100 ml of water for 1-2 hrs. Alternative Procedure for Faster Staining: We will use this procedure 1) Following SDS-PAGE, place gel in clean dish. Rinse gel twice with 100 ml water pre-heated to 70-90°C (5 min each wash). 2) Mix the Colloidal Blue Stain Reagent just before use by gently inverting and swirling the reagent bottle. The instructor will do this step and pre-heat the dye for you. 3) Discard water wash from gel and add 20-30 ml of the pre-heated Colloidal Blue Stain Reagent. Protein bands should be visible within 5-10 min. Destain gel with 100 ml of water for 10-20 min. You may take a picture immediately or leave your gel in water in the refrigerator till the next class. Hint: This is data, it should go in your notebook. Alternate procedures (which we will not use in class): Microwave gel plus stain for 1 min or until solution begins to boil or put the tray containing the gel and stain reagent may be placed on a hot plate and heated until the solution begins to boil. Remove from hot plate. Protein bands should be visible within 5-10 min. If desired, destain gel with 100 ml of water for 10-20 min. References: This document has been adapted from “Bacterial Transformation” http://plaid.hawk.prattsburgh.edu/faculty/slsh/tranformation.html Transformation and gene expression protocol has been adapted from the procedure suggested by Protein Express, Inc. 45 45See Answer
Q6:1. In tomato, tall plant growth dominates over short plant growth, smooth epidermis over rough epidermis. A cross between two plants produced the following number of offspring: 208 high smooth, 9 high rough, 6 low smooth, 195 low rough plants. Explain the results. Identify the genotypes of the original plants and their phenotypes 2. Construct a genetic map using the results of two analyzing crosses of AaBbCc triheterozygotes: Phenotypic classes Crossbreeding №1 Crossbreeding №2 I ABC 126 84 ABC 10 76 AbC 64 82 Abc 62 78 aBC 68 86 aBc 70 74 abC 14 82 abc 133 80 547 642 totalSee Answer
Q7: • dystrophy, etc ARTICLE SOURCES: You are able to use multiple databases to help find relevant information for your topic such as Google Scholar, PubMed, and Alabama Virtual Library, etc. Make sure that any source you do choose meet the following guidelines: - You may only consider articles published after 2014 It must have at least three (3) pages of written content It must be relevant to scientific research (ex. genetics, population genetics, DNA, RNA, Proteins etc.) PART ONE - ARTICLE ANNOTATION: In order to properly communicate the information of your topic, you will need to do some background research on the topic. Begin your background research by conducting a SCIENCE ARTICLE SHARE GENETICS PROJECT PURPOSE/BACKGROUND A major part of science is investigating. This assignment will allow you the chance to follow science news stories and engage in exploration of different topics relevant to the material we have already learned or what we will learn in the near future. This particular project will focus on Genetic Disorders. There are three parts to this project that you will need to submit in order to be eligible for full credit PROJECT COMPONENTS: Annotated Article (15 points) Article Review and Summary (40 points) Presentation (45 points) Now, it is time to decide which topic you and your partner will present to the class. SAMPLE TOPICS Cystic fibrosis, DiGeorge syndrome, Down syndrome, Duchenne muscular general search for articles that are relevant to the topic you want to present. Once you have found a few, choose one to be your primary source and use the other articles to provide additional information about your topic. Next, read and annotate the chosen article. For your annotations you can write down vocabulary terms, key concepts, things that you are unfamiliar with or believe to be key to understanding the main idea of the article, etc. From this exercise you will have a pretty good idea of what background information the class is likely to already understand, and which information you will need to research and elaborate on during your presentation. In the end, you should be able to define all technical terms and generally explain any key concepts that would help your audience understand your topic. The other articles that you found during your background research will serve as support information for your presentation. In the end you should have at least three (3) scientific/scholarly articles as your sources. You will need to agree on a topic over the next few days and finalize your article/topic no later than Friday, April 5, 2024. Once you have identified your potential topic, one group member must complete the topic request form. Topics may not be duplicated in one class period therefore, they must be officially approved by the teacher. Articles/Topics will be officially approved in the order in which they are received. PART TWO - ARTICLE SUMMARY AND CRITIQUE: This portion of your project should be at least one page long double spaced. It includes two parts: the article summary and critique. SUMMARY: (250 words) This is where you will pick out major concepts and ideas from the article to provide an overview. In this section, you may also include interesting facts that you learned while reading this article. Make sure when you use information from the article that you are citing the article using its title or the last name of the author. Critique: (250 words) This is where you will give honest feedback about the article. Decide what you enjoyed about the article and what would have made it better. Was it too long? Was it well organized and did it have a good flow? For every negative critique you must provide a suggestion of how to make it better in the future. PART THREE - PRESENTATION: You may choose to use a PowerPoint (6-8 slides; not including title slide) or design a website to present the material found from your background research. You are expected to fill a 5 minute time block. This will allow for multiple groups per presentation date plus ample time for questions and discussion from the teacher and peers. Your presentation should include the following information Source Citation(s) ex. title, author(s), date, literature source in APA Format. Table of Contents • Technical vocabulary terms (you must be able to define them) • Purpose/Research Question (Learning Objective) • Introduction/Background ● Key Concepts (at least 5) - - Symptoms or Physical Attributes associated with the disease How is it inherited? Pedigree Chart or Punnett Square Is it a dominant or recessive trait? Are there any current Treatments or Genetic Technology to help fight this disease? Which ethnic and age demographics does it impact the most? Death/Survival Rate What is the Importance of the research of this disease? Key Scientists involved in research of the disease. Personal Connection to Disorder • Audience Interaction · You may also incorporate images, figures, diagrams, maps, etc, to help illustrate key points. ***Do not clutter your slides with too much text or irrelevant figures. All parts of the project need to be submitted on time along with your annotated printed copy of the article. Participation in the Audience: Your responsibility as a member of the audience is to ask questions after the presentation. Your questions may be as simple as requesting the definition of a technical term not defined during the presentation, or clarification of a concept. PRESENTATION DATES: Project due April 15, 2024 Presentations will begin April 15, 2024 - April 18, 2024. NAME: PRESENTATION DATE: TOPIC: PRESENTATION RUBRIC POINTS AVAILABLE POINTS RECEIVED 10 Points Category Grammar Mechanics: Student submitted a presentation with less than 3 grammatical errors Quality of Information: Students presented relevant and accurate information to the class. Organization: The students arrived with all materials and presented a well-prepared presentation. Knowledge of Content: Students were able to present their research topic without relying heavily on their notes. 15 Points 5 Points 15 points ARTICLE SUMMARY AND CRITIQUE RUBRIC Grammar Mechanics: Student submitted a presentation with less than 3 grammatical errors. The student cited the article correctly. Quality of Information: Students include the most relevant and accurate main ideas in their summary. Student provide a balanced sample of positive and negative attributes about the article. The student Organization: The summary is written in a standard flow of logic. 15 Points 15 Points 10 Points ACADEMIC INTEGRITY POLICY Academic integrity and honesty are fundamental values in a student's education. Students are expected to do their own work to gain appropriate credit. Students, therefore, are expected to submit their own work at all times. To commit academic dishonesty is to violate anyone's or one's own personal honesty, integrity, and character; and is not limited to any single type of action. It unacceptable behavior for students to ask, borrow, copy, or rewrite another person's work or thinking. In addition, any participation in academic dishonesty cheapens and degrades the academic quality of the entire school or institution. Consequently, A STUDENT MUST NOT: turn in an assignment, homework, test, paper, or project that is not entirely his or her own work, effort, or ideas; submit the same paper or project for two or more classes without the knowledge and approval of all teachers; use another person's ideas, structures, words, or phrases without giving proper acknowledgements or in other words plagiarize. PLAGIARISM: is scholarly theft, and it is defined as the unacknowledged use of secondary sources. More specifically, any written presentation in which the writer does not distinguish clearly between original and borrowed material constitutes plagiarism. It may be intentional or unintentional; thus, the student is responsible for his or her honesty and truthfulness in their scholarship. This definition of plagiarism is also applicable to all Internet material. Borrowing or buying a research paper written by someone else also constitutes plagiarism. Because students, as scholars, must make continuous use of the concepts and the facts developed by other scholars, plagiarism is not mere use of another's facts and ideas. However, it is plagiarism when students present the work of other scholars as if it were their own work. There are a number of instances where students can be certain that they are not plagiarizing: referring to commonly known facts is not plagiarism students may refer in their own words to generally known and widely accepted ideas or theories without fear of plagiarism as long as they do not copy the plan, structure, outline, or organizational scheme used by another scholar. Plagiarism is committed in a number of ways: a. reproducing another author's writing as if it were one's own. b. paraphrasing another author's work or ideas without citing the original owner of the material. C. d. borrowing another author's ideas, even though they are reworded without giving credit to the original owner. copying another author's organization, structure, outline, or plan without giving credit. Plagiarism is avoided when students give credit (in parenthetical citation style) to the source in the following instances: a. when quoting directly from someone else's writing. A direct quotation must always be enclosed in quotation marks. Using three words or more from the original source material is considered quoting rather than paraphrasing and thus should be treated accordingly. b. when paraphrasing someone else's writing. To paraphrase means to restate a passage from someone else's writing completely in one's own words. However, a parenthetical citation is still required because ideas and concepts were copied. C. when following the outline or structure of another author's argument, explanation, or theory--even though the material is summarized in one's own words. The standard penalty for plagiarism is a zero grade for the assignment in which the plagiarism occurs.See Answer
Q8:3. The recognition cutting sites of 2 different enzymes (enzymes A: blue star; enzyme B: red triangle) are shown in the map below. In your answer include: a) A prediction of the size (in bp) of the resulting fragments after digestion of the amplicon with the two enzymes mixed together (Mix), when each enzyme is used separately (A and B) and when no enzyme (NO) is used. b) A drawing of these fragments onto the graph below to represent a gel electrophoresis. You can either recreate the picture e.g. in PowerPoint/paint/others and then paste this in your research paper or print this, draw on it, and take a picture of it and then upload this on the research paper. Doesn't need to be perfect but the bands size difference MUST be clear.See Answer
Q9:In this lab you will first simulate the preparation of a PCR which will be carried out to amplify a fragment of a gene which may contain the causative SNP. The PCR products will then be digested with an enzyme to discover whether the 'normal type' or 'disease type' of the allele is present in your samples. The samples will then be analysed by gel electrophoresis.See Answer
Q10: REQUEST FOR PROPOSALS (RFP) GLOBAL AND REGIONAL ENVIRONMENTAL CHANGE PROGRAM An Application Guide West Virginia University Biology 321 Science Foundation BSF-24-1 January 2024 Open Invitation To Submit Proposals January 1, 2024 Dear Scientist, Thank you for your interest in the Biology Science Foundation's Global and Regional Environmental Change Program. The West Virginia University Biology Science Foundation (BSF) is a pseudo-government agency founded in 1993. The Foundation was created by the staff of Biology 321. Its aim is to promote and advance knowledge of pressing problems in environmental and evolutionary biology. BSF welcomes proposals on behalf of all qualified Biology 321 students. Awardees are wholly responsible for conducting their project activities and preparing the results for publication. This packet contains five items to assist you in your proposal preparation: (1) the program announcement (describing the needs of the program), (2) guidelines for preparation of pre- proposals, (3) guidelines for preparation of proposals, (4) proposal review procedures and criteria, (5) appendices (containing standard forms to be used for the proposal cover sheet and budget). We look forward to receiving your pre-proposals and proposals! Sincerely, Kevin J. Barry BSF Program Director Associate Program Directors: Cameron Corbett Hannah DeHetre Emel Kangi Table of Contents I. II. III. IV. PROGRAM ANNOUNCEMENT PROPOSAL OUTLINE GUIDELINES GUIDELINES FOR PREPARATION OF PROPOSALS PROPOSAL REVIEW I. Program Announcement Ecology is the study of the relationship of organisms to their natural environments, including physical factors and other organisms. On global and regional scales, one species is having inordinately large effects on the rest. That species is Homo sapiens. Environmental change wrought by H. sapiens is occurring on a scale not seen since the extinction of the dinosaurs 65 million years ago. In essence, our species is performing one giant, uncontrolled experiment on the globe. Many fear drastic consequences of this experiment. Indeed, the evidence is already mounting that drastic consequences have already occurred (an iceberg the size of Rhode Island breaking off in Antarctica!), but that these may be only the tip of the iceberg (no pun intended!). For example, acid rain, in combination with pollutants, has undoubtedly been responsible for decimation of the majestic forests of eastern Europe and depletion of the formerly trout-filled streams of the Adirondack Mountains of New York. Chlorofluorocarbons (CFCs) are causing a breakdown of the ozone layer and this has already shown up over Antarctica and the Arctic as a "hole" in the atmosphere through which damaging ultraviolet radiation can penetrate. Burning of fossil fuels has led to increases in atmospheric carbon dioxide from ca. 270 ppm (parts per million) in the mid-1800s to 400 ppm now, and meteorological, geological and oceanographic data point to global warming over the past few decades. Numerous more regional and localized environmental changes are occurring as well and will affect ecosystems, communities, populations and individuals in important ways. We have only begun to investigate what effect these environmental changes will have on the rest of the species with whom we share this planet. This is where the science of ecology comes in. Of prime importance is the effect on plants because plants are the "engines" of the world's ecosystem - they take the energy in sunlight and, through photosynthesis, incorporate it into the biosphere, thus "driving" the rest of the ecosystem. Thus, if plants are adversely affected by global or regional environmental change, the rest of the system cannot help but be affected as well. Over the past decade many studies of single factor effects on certain species of plants and animals have been performed. For example, many studies have asked “How will plants respond to a doubling of CO2 in the atmosphere?” However, increasingly ecologists are finding that the response of different species or genotypes to a given factor may differ. For example, do the effects of elevated CO2 differ for C-3 species and C-4 species? Or, does the effect of acid precipitation differ for spruce trees vs. pine trees? Moreover, ecological geneticists ask whether the effects of an environmental variable depend on the genotype. Effects of a factor may also depend on the levels of another factor - in other words, for a given species, 2 factors may show a dependency on the levels of each other; an ‘interaction', in a statistical sense. For example, does the effect of CO2 depend on the level of acid precipitation? Why? At a high CO2 level, a plant may gain more carbon through photosynthesis and be better able to withstand the negative effects of acid precipitation than when CO2 levels are low. All of these examples show that we cannot readily predict the consequences of global or regional environmental change without explicitly designing experiments that includes different species or genotypes, or examine two-factor effects on a species. Proposed studies should address the possible importance of two-way interactive effects (species x factor, genotype x factor, or factor x factor). The BSF is interested in supporting research using either model systems OR representatives of native species for which environmental change is a particular concern. It will not be possible to work with vertebrate species due to animal care protocol requirements which cannot be met in the time-frame of this course. Within these broad parameters, investigators are free to propose a study of virtually any environmental factor(s) changing or presenting a stress in the present environment for certain organisms. Your research advisor may narrow your choices slightly by choosing a 'theme' for your lab section. Priority will be given to those proposals that have an explicit and well-thought-out rationale for examining particular species, genotypes, or factors. Investigators are particularly encouraged to use well- chosen 'species' or 'genotypes' as one of the factors. Please see proposal review criteria for further details on how to maximize your chances of funding. II. Proposal Outline Guidelines A. Format Proposal outlines should be comprised of a one-page description of your planned project, including: (A) Tentative Title of proposal (B) Names of Principal Investigators (P.I.s); Triad #; Name of TA (C) Statement of the question being addressed (D) Statement of why this question is important (E) What species (or community or soil or ecosystem) will you use as your experimental system? (F) List the independent variables (i.e., 'factors') in your experiment (G) List the planned 'levels' of each factor (H) List the dependent variables you plan to measure on your target organism (or system) (I) State what the implications of your findings could be (J) Seed germination / plant propagation requirements. (K) References; give at least one reference on your topic from the scientific literature B. Criteria for judging proposal outlines. •Title should adequately describe the project, including the factors and organism/system to be investigated. •Names of P.I.s/TA/Triad Number should be included. •Question statements. The questions should clearly address the potential for an interactive effect' between the two factors being varied in the experiment. 10 pts •The 'Why Is This Important' justification for the question. It should be clear how the question addresses a novel problem and why the question is an interesting one. 10 pts. •Experimental system/species. The species to be used must be (a) practical for experimental study, (b) affordable for TSE program, (c) easy to cultivate/grow/raise, (d) relevant to the question being addressed. 10 pts. •Independent variables. Two. It must be possible to manipulate them independently. They must be practical for inexpensive manipulation. They must not be dangerous or require special or expensive conditions. 10 pts. •Levels of each factor. Chosen for a reason. Span a range that may be expected to have biological effects. 10 pts. •Dependent variables. Do-able using the equipment/facilities available. Meaningful in terms of addressing the question. Practical for the organism/system of choice. 10 pts. •Significance. What are the potential implications of your expected findings? Show thought about what inferences could be made with alternative possible outcomes. 10 pts. •Seed germination / plant propagation requirements. Must explain germination /propagation process, requirements, and timeline. 10 pts. •References. Must list one scientific reference on the chosen topic. 10 pts./n Background/Introduction citations https://www.sciencedirect.com/science/article/abs/pii/B9781893997943500209 - discusses nutritional uses of sunflowers, such as benefits of sunflower oils https://www.annualreviews.org/doi/full/10.1146/annurev.environ.041008.093740 - discusses the importance of crop yield maximization as well as the importance of focusing on crop yield in the future due to growing populations https://acsess.onlinelibrary.wiley.com/doi/epdf/10.2134/agronj1988.00021962008000050 017x - Focuses on how light affects the growth of sunflower plants https://link.springer.com/chapter/10.1007/978-0-387-77594-4_6 - States the importance https://aocs.onlinelibrary.wiley.com/doi/epdf/10.1007/BF02582585 - Sunflower use in https://www.mdpi.com/2311-7524/9/10/1079 - use of sunflowers in biofuel https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8069385/ - introduction states that sunlight levels vary longitudinally and there is shorter sunlight duration in northern countries of sunflowers in world trade America https://www.annualreviews.org/doi/pdf/10.1146/annurev.py.30.090192.002525?casa_toke n=i-pF2b-zF34AAAAA%3ARJSwj_bsCK-ExJ7K6i47XtV9y8AAOVgM7mDg8C0VxyZ -yeKCOa-uPcAGh1EWm2MtKTBNThlq02w - says sunflowers are grown worldwide Introduction- MOHAMMAD Sunflower agricultural uses (sunflower oil, etc.) Issues of overpopulation and the need to maximize crop yields How sunlight varies by region and sunflowers are found in lots of regions Identifying how sunlight varies by region can help us to show why we chose sunlight as a factor; using light levels to mimic different regions with their varying levels of sunlight can help us understand how to maximize densities of sunflowers in different regions Background-GROUP EFFORT Sunflower growth stages, regions of the world, and agricultural uses https://link.springer.com/chapter/10.1007/978-1-4614-0356-2_4 - article all about sunflowers (history, background, growth, physical appearance, etc.) Related experiments on sunflower reactions to light and density (find similar studies) https://iopscience.iop.org/article/10.1088/1755-1315/752/1/012019/pdf - discusses changes in growth in sunflowers as a result of varying levels of light https://cdnsciencepub.com/doi/pdf/10.4141/cips84-084 - discusses changes in growth in sunflowers as a result of varying densities Objectives/Questions/Hypotheses- MAYA Research Plan- ABBY Number each pot 1-15 for each testing group (sunlight low density, sunlight high density, shade low density, shade high density) Put 60% shade cloths over shaded test groups Chose 60% to ensure that some sunlight still reached the plants, but enough was restricted to see adequate differences https://eyouagro.com/blog/greenhouse-shade-cloth-guide/ - talks about shade cloth percentages and when they should be used – make sure this is a reputable source Water once a week (amount not yet determined) - same amount for each sample Check weekly height and SPAD reading for 5 plants in each testing group (ruler measured in centimeters and SPAD meter) Use random number generator in week 1 to determine plants being tested to avoid bias - conduct weekly checks on these plants only in concurrent weeks to keep consistency (reduces risk of human error due to high number of samples) Height and SPAD readings will be averaged in pots containing four seedlings Citation on how SPAD readings are good indicators of photosynthesis rates https://acsess.onlinelibrary.wiley.com/doi/abs/10.2135/cropsci1995.00111 83X003500050025x?casa_token=UyhklMequ0QAAAAA:lAgiPV56Heeu QyK-s15mwjnMJxP_-6H1UBDjqfHeSz7YlnKWZ0BChejNpgihqN0uk00 nNmxAaulIrg At end of experiment, place tester plants in drying chamber and take average dry biomass of each of the five samples from each testing group (pots with four plants will be averaged to compare to pot with single plant) - ensures latent water does not modify our results Compare average dry biomass and weekly height and SPAD readings from each group Conduct p-test and determine statistical significance of results Expected Significance- TROY Seed Germination/Propagation- GROUP EFFORT/nNeed to do only Introduction part in 600-700 words double spaced Student name is MOHAMMAD Introduction- MOHAMMAD - Sunflower agricultural uses (sunflower oil, etc.) Issues of overpopulation and the need to maximize crop yields How sunlight varies by region and sunflowers are found in lots of regions - Identifying how sunlight varies by region can help us to show why we chose sunlight as a factor; using light levels to mimic different regions with their varying levels of sunlight can help us understand how to maximize densities of sunflowers in different regions Note from professor : Mohammad, We all picked sections to do and we figured introduction should be the most general so it should be the easiest to do having not been here. On ecampus there is a file labeled request for proposals under week 1 that has most of the information that you will need. If you have any questions or anything just let us knowSee Answer
Q11: Assessment 3 field trip re... Home: CIA Workplace Topic MyTimetable A Allocate+ Student Assessment Assessment 3 requires that you apply your understanding and critical analysis skills to address the broad topic of whether sustainable food and fibre production systems can be designed to meet the needs of an increasing population. You need to use information you have gained from two of the three field trips. In this assessment task, you are required to: 'Compare and contrast two of the agribusinesses visited during the field trips as they relate to the concepts of a managed ecosystem and sustainability principles (environmental, social and economic). Are the agribusinesses sustainable as presently operating? Use examples from the field trip and the literature to support your answer.' You should prepare a written report of around 2000 words and include some appropriate references. To remain within the recommended word count, it is suggested that you restrict your analysis of the environmental sustainability to two of the following areas. This permits a more in-depth analysis of environmental sustainability: biodiversity and stability • energy and productivity • nitrogen cycle (maintenance of fertility) • detritus cycles/soil organic carbon • the hydrological cycle (managing water resources) Note, however, that you are still required to analyse economic and social sustainability at the two agribusinesses. It will be important to take detailed notes during the field trips, for use as examples to support your analysis of the topic. Feel free to include photos in your report water resources) Mucates Student Note, however, that you are still required to analyse economic and social sustainability at the two agribusinesses. It will be important to take detailed notes during the field trips, for use as examples to support your analysis of the topic. Feel free to include photos in your report Structure You are free to structure the report in a way that makes sense to you. Two suggested ways are: 1. You could start with a section giving an overview of the two enterprises, and then compare them under headings of economic, social, and environmental sustainability 2. Or you could instead review the first enterprise under each of these headings, and then the second one, and compare the two in your conclusion An abstract or synopsis is not required for the report, but you will need to include a conclusion giving your overall perspective on how the two operations you choose compare, and whether you ultimately believe they are sustainable. Also, you could include any overall recommendations that you have for the businesses. Feel free to include photos in your report (although they won't affect your grade). Referencing Although this is a field trip report rather than an essay, you are still required to reference your sources of information. You do not have to repeatedly reference the same source - for example, you could start a paragraph along these lines: "The current owner and manager of Leap Farm, lain Field, outlined several aspects of their herd management principles as follow "and then not mention the source again until you change source Assessm ö Referencing Although this is a field trip report rather than an essay, you are still required to reference your sources of information. You do not have to repeatedly reference the same source - for example, you could start a paragraph along these lines: "The current owner and manager of Leap Farm, lain Field, outlined several aspects of their herd management principles, as follow..... and then not mention the source again until you change source. The "personal communication" mode of referencing is often used for information that is obtained verbally or not from a published source (such as information directly from the growers we met). Details on how to use this referencing type is found here . It is more common to use that for single sources within a report or paper when you are mostly using published sources. Given the field report will have a great deal of content from the farm managers we spoke to, it is OK to simply state the persons name at the start of a paragraph. Your other information sources should be used to support your content and should also be referenced (in-text citation, plus details in the reference list) using the APA 7th edition style. Assessment You can find the assessment rubric here (docx, 18.5KB), which will be used to grade your report. You will not be penalized being higher or lower than the recommended 2000 word count.See Answer
Q12: INSTRUCTIONS Data is given in the document There are 51 questions you don't need to answer them, you will do the lab report only and you will provide the graphs and the anova results You have to do it as per the rubric and provide the reference as well Experiment is about barb fish - it is also mentioned in the document Student note The two figures also should be included in the report under results section and with a description underneath as in the rubric Need outside references and cannot use the introduction section which is in the document/n Methods Information Worksheet Fill out the following information as best that you can for your study. Not every question will be applicable to your specific experiment or study system, especially if you are doing a field study. Depending on how prepared you are to begin your experiment, you may not be able to fill out all of this information today-remember to come back to anything you skipped and fill it out later! If you run into anything you're not 100% sure about, ask your TA or lab coordinator so that they can help you finalize your experiment. Keep this sheet to use as a reference later when you go to write your rough draft and final paper. Holes closer to front KIA CELL: 9163173526 STEPH CELL: Standard error of median: 1.253 x SEM Stress behaviors: average of stress behaviors for all treatment groups in a bar graph: error bars for standard error of mean Discussion section: reliability include multiple replicates of demonstrators that could tell us the tank of demonstrators was particularly good or bad and then take the average between those tanks for a more accurate view for how the fish learn; restraints of class Median Maze Completion Time of School (s) 300 270 240 210 180 150 120 90 60 30 0 1 2 3 4 5 6 7 8 9 10 11 12 Trial Number 13 14 Excel data below ⚫Control 25% demonstrators 37.5% demonstrators 50% demonstrators 1 of 19 SE SE median 300 12.569805 4.189935 5.2499886 300 9.1923882 3.0641294 3.8393541 216 48.843043 16.281014 20.400111 50 4.1382363 1.3794121 1.7284034 31 13.287346 4.4291154 5.5496816 36 10.273927 3.4246423 4.2910768 47 92.642843 30.880948 38.693828 80.5 139.13553 46.378511 58.112274 110.5 93.321162 31.107054 38.977139 45.5 116.35874 38.786248 48.599168 41.5 124.62744 41.542482 52.052729 25 127.61298 42.537658 53.299686 39.5 118.86607 39.622024 49.646396 87.5 80.002567 26.667522 33.414405 16.5 8.5596645 2.8532215 3.5750866 15 8.0256286 2.6752095 3.3520375 7 12.339686 4.1132288 5.1538756 6.5 11.236897 3.7456324 4.6932774 9.5 10.82243 3.6074768 4.5201684 4 9.3808315 3.1269438 3.9180606 3.5 3.3990545 1.1330182 1.4196718 145.5 42.473311 14.15777 17.739686 76.5 78.74178 26.24726 32.887817 154 51.920097 17.306699 21.685294 133.5 65.130501 21.710167 27.202839 41.5 29.594582 9.8648607 12.36067 21.5 46.909487 15.636496 19.592529 48.5 18.258071 6.0860235 7.6257875 24.5 10.69045 3.5634832 4.4650445 treatment groɩ Median time stdev control control control control control control control control control control control control control control 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.375 0.375 0.375 0.375 0.375 0.375 0.375 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 17.5 0.5 0.5 0.5 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.375 0.375 0.375 0.375 0.375 0.375 0.375 13 15.175168 5.0583892 6.3381617 9.5 18.703991 6.2346637 7.8120336 12.5 33.613082 11.204361 14.039064 10.5 40.530192 13.510064 16.92811 7.5 101.56903 33.856343 42.421998 17 67.811582 22.603861 28.322638 9.5 1.407886 0.4692953 0.588027 11 11.389218 3.796406 4.7568967 8 28.154865 9.384955 11.759349 16.132819 5.3776064 6.7381408 24 10.514446 3.5048153 4.3915335 19.5 19.398085 6.4660284 8.1019336 38.5 51.135674 17.045225 21.357666 4.5 21.293862 7.0979541 8.8937365 5.5 6.4972522 2.1657507 2.7136857 5 1.1649647 0.3883216 0.4865669 4 1.3887301 0.46291 0.5800263 3 1.0350983 0.3450328 0.4323261 1.5 6.0812945 2.0270982 2.539954 3 15.609063 5.2030211 6.5193854 17 1.5059406 0.5019802 0.6289812 10.5 14.33278 4.7775932 5.9863243 8 8.5178384 2.8392795 3.5576172 8.5 39.376389 13.125463 16.446205 62 35.894438 11.964813 14.99191 16.5 29.061511 9.6871704 12.138024 74 14.297228 4.7657425 5.9714754 2 of 19 12 10 8 ||.|| 0 Control 25% Demonstrators 37.5% Demonstrators 50% Demonstrators Treatment Group treatmemt grou Mean behavio STDEV Control 25% Demo 3.9285714 1.7743595 37.5% Demo 8.7857143 3.9258232 50% Demor 7.5714286 3.1061796 9.2142857 2.5773741 SE 0.6965876 0.4795566 1.0610333 0.839508 3 of 19 Oneway Anova Summary of Fit Analysis of Variance Sum of Source DF Squares Mean Square fish 3 83064.14 Error 52 161242.71 27688.0 3100.8 8.9293 F Ratio Prob > F <.0001* C. Total 55 244306.86 ▾ Means for Oneway Anova Level Number Mean Std Error Lower 95% Upper 95% 0.5 14 17.143 14.882 -12.72 47.01 0.25 14 7.214 14.882 -22.65 37.08 0.375 14 60.929 14.882 31.06 90.79 control 14 104.143 14.882 74.28 134.01 Std Error uses a pooled estimate of error variance Means Comparisons ▼ Comparisons for all pairs using Tukey-Kramer HSD ▸ Confidence Quantile ▸ HSD Threshold Matrix ▸ Connecting Letters Report Ordered Differences Report Level - Level Difference Std Err Dif control 0.25 0 50 100 150 96.92857 21.04696 41.0679 control 0.5 87.00000 21.04696 31.1393 Lower CL Upper CL p-Value 152.7893 0.0002* 142.8607 0.0007* 0.375 0.25 53.71429 0.375 0.5 43.78571 21.04696 21.04696 -2.1464 109.5750 0.0636 -12.0750 99.6464 0.1730 control 0.375 43.21429 21.04696 -12.6464 99.0750 0.1822 0.5 0.25 9.92857 21.04696 -45.9321 65.7893 0.9650 4 of 19 Oneway Anova Summary of Fit Rsquare 0.348216 Adj Rsquare 0.310613 Root Mean Square Error 2.951764 Mean of Response Observations (or Sum Wgts) ▾ Analysis of Variance 7.375 56 Sum of Source DF Squares Mean Square fish ratio 3 242.05357 Error 52 453.07143 80.6845 8.7129 F Ratio Prob > F 9.2603 <.0001* C. Total 55 695.12500 Means for Oneway Anova Means Comparisons Comparisons for all pairs using Tukey-Kramer HSD ▸ Confidence Quantile HSD Threshold Matrix ▸ Connecting Letters Report ▾ Ordered Differences Report Level - Level Difference Std Err Dif control 0.25 5.285714 1.115662 0.375 0.25 4.857143 1.115662 0.5 0.25 3.642857 1.115662 0.68178 6.603934 0.0101* control 0.5 1.642857 1.115662 -1.31822 4.603934 0.4611 0.375 0.5 1.214286 1.115662 -1.74679 4.175363 0.6981 control 0.375 0.428571 1.115662 -2.53251 3.389649 0.9805 Lower CL Upper CL p-Value -20 2 4 6 8 2.32464 1.89607 8.246792 <.0001* 7.818220 0.0004* Part 1: Study system 1. What is the scientific name of your animal(s)? → Puntius Tetrazona (Tiger Barbs) 2. Are you testing other phenotypes, strains, or hybrids than just the wild type? If so, list the phenotypes/strains/hybrids you will be using. → No, only Wild type 3. How many individuals will you test of each phenotype/strain/hybrid, including the wild type? We have a total of 24 tiger Barbs 5 of 19See Answer
Q13:Device: Surgical mesh for hernia repair Small paragraph (no more than 100 words) Include figures or tables if available Make it in 80-100 words Topic: Materials used for the device Follow the ACS format for the various reference types: https://pubs.acs.org/doi/full/10.1021/acsguide.40303See Answer
Q14:The ACS Guide to Scholarly Communication pubs.acs.org Device: Coronary stents Small paragraph (no more than 100 words) Include figures or tables if available Topic: Materials used for the device Follow the ACS format for the various reference types: https://pubs.acs.org/doi/full/10.1021/acsguide.40303See Answer
Q15:Medical device: Surgical Mesh for hernia repair Each student must study the device and answer: What is the most significant clinical issue? What material properties cause this issue? (100-200 words).See Answer

TutorBin Testimonials

I found TutorBin Biotechnology homework help when I was struggling with complex concepts. Experts provided step-wise explanations and examples to help me understand concepts clearly.

Rick Jordon

TutorBin experts resolve your doubts without making you wait for long. Their experts are responsive & available 24/7 whenever you need Biotechnology subject guidance.

Andrea Jacobs

I trust TutorBin for assisting me in completing Biotechnology assignments with quality and 100% accuracy. Experts are polite, listen to my problems, and have extensive experience in their domain.

Lilian King

I got my Biotechnology homework done on time. My assignment is proofread and edited by professionals. Got zero plagiarism as experts developed my assignment from scratch. Feel relieved and super excited.

Joey Dip

Popular Subjects for biotechnology

You can get the best rated step-by-step problem explanations from 65000+ expert tutors by ordering TutorBin biotechnology homework help.

TutorBin helping students around the globe

TutorBin believes that distance should never be a barrier to learning. Over 500000+ orders and 100000+ happy customers explain TutorBin has become the name that keeps learning fun in the UK, USA, Canada, Australia, Singapore, and UAE.