tutorbin

biotechnology homework help

Boost your journey with 24/7 access to skilled experts, offering unmatched biotechnology homework help

tutorbin

Trusted by 1.1 M+ Happy Students

WhatsApp Support

Get Instant
Online Homework Help
via WhatsApp

Get instant homework help from top tutors—just a WhatsApp message away. 24/7 hw help support for all your academic needs!

A
S
M
R
★★★★★
2M+ students trust TutorBin
Your WhatsApp Number
phone
or
⚡ Instant reply
🔒 100% private
👨‍🏫 Top tutors
🌍 All subjects
*Get instant homework help from top tutors—just a WhatsApp message away. 24/7 support for all your academic needs!
2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee

Recently Asked biotechnology Questions

Expert help when you need it
  • Q1:2. Given the below DNA sequence and the given Forward primer sequence (highlighted in yellow), design the reverse primer sequence (of a 20bp length) that you would have to purchase if you want to generate a 876bp amplicon. GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTG CTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCC AGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTG ATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGG GGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCA CACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTG CCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGG GGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGAC TGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGA CAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGT GTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGA CAGGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGG TCCTGGGGATAGGGGSee Answer
  • Q2:In this lab you will first simulate the preparation of a PCR which will be carried out to amplify a fragment of a gene which may contain the causative SNP. The PCR products will then be digested with an enzyme to discover whether the 'normal type' or 'disease type' of the allele is present in your samples. The samples will then be analysed by gel electrophoresis.See Answer
  • Q3:3. The recognition cutting sites of 2 different enzymes (enzymes A: blue star; enzyme B: red triangle) are shown in the map below. In your answer include: a) A prediction of the size (in bp) of the resulting fragments after digestion of the amplicon with the two enzymes mixed together (Mix), when each enzyme is used separately (A and B) and when no enzyme (NO) is used. b) A drawing of these fragments onto the graph below to represent a gel electrophoresis. You can either recreate the picture e.g. in PowerPoint/paint/others and then paste this in your research paper or print this, draw on it, and take a picture of it and then upload this on the research paper. Doesn't need to be perfect but the bands size difference MUST be clear.See Answer
  • Q4: REQUEST FOR PROPOSALS (RFP) GLOBAL AND REGIONAL ENVIRONMENTAL CHANGE PROGRAM An Application Guide West Virginia University Biology 321 Science Foundation BSF-24-1 January 2024 Open Invitation To Submit Proposals January 1, 2024 Dear Scientist, Thank you for your interest in the Biology Science Foundation's Global and Regional Environmental Change Program. The West Virginia University Biology Science Foundation (BSF) is a pseudo-government agency founded in 1993. The Foundation was created by the staff of Biology 321. Its aim is to promote and advance knowledge of pressing problems in environmental and evolutionary biology. BSF welcomes proposals on behalf of all qualified Biology 321 students. Awardees are wholly responsible for conducting their project activities and preparing the results for publication. This packet contains five items to assist you in your proposal preparation: (1) the program announcement (describing the needs of the program), (2) guidelines for preparation of pre- proposals, (3) guidelines for preparation of proposals, (4) proposal review procedures and criteria, (5) appendices (containing standard forms to be used for the proposal cover sheet and budget). We look forward to receiving your pre-proposals and proposals! Sincerely, Kevin J. Barry BSF Program Director Associate Program Directors: Cameron Corbett Hannah DeHetre Emel Kangi Table of Contents I. II. III. IV. PROGRAM ANNOUNCEMENT PROPOSAL OUTLINE GUIDELINES GUIDELINES FOR PREPARATION OF PROPOSALS PROPOSAL REVIEW I. Program Announcement Ecology is the study of the relationship of organisms to their natural environments, including physical factors and other organisms. On global and regional scales, one species is having inordinately large effects on the rest. That species is Homo sapiens. Environmental change wrought by H. sapiens is occurring on a scale not seen since the extinction of the dinosaurs 65 million years ago. In essence, our species is performing one giant, uncontrolled experiment on the globe. Many fear drastic consequences of this experiment. Indeed, the evidence is already mounting that drastic consequences have already occurred (an iceberg the size of Rhode Island breaking off in Antarctica!), but that these may be only the tip of the iceberg (no pun intended!). For example, acid rain, in combination with pollutants, has undoubtedly been responsible for decimation of the majestic forests of eastern Europe and depletion of the formerly trout-filled streams of the Adirondack Mountains of New York. Chlorofluorocarbons (CFCs) are causing a breakdown of the ozone layer and this has already shown up over Antarctica and the Arctic as a "hole" in the atmosphere through which damaging ultraviolet radiation can penetrate. Burning of fossil fuels has led to increases in atmospheric carbon dioxide from ca. 270 ppm (parts per million) in the mid-1800s to 400 ppm now, and meteorological, geological and oceanographic data point to global warming over the past few decades. Numerous more regional and localized environmental changes are occurring as well and will affect ecosystems, communities, populations and individuals in important ways. We have only begun to investigate what effect these environmental changes will have on the rest of the species with whom we share this planet. This is where the science of ecology comes in. Of prime importance is the effect on plants because plants are the "engines" of the world's ecosystem - they take the energy in sunlight and, through photosynthesis, incorporate it into the biosphere, thus "driving" the rest of the ecosystem. Thus, if plants are adversely affected by global or regional environmental change, the rest of the system cannot help but be affected as well. Over the past decade many studies of single factor effects on certain species of plants and animals have been performed. For example, many studies have asked “How will plants respond to a doubling of CO2 in the atmosphere?” However, increasingly ecologists are finding that the response of different species or genotypes to a given factor may differ. For example, do the effects of elevated CO2 differ for C-3 species and C-4 species? Or, does the effect of acid precipitation differ for spruce trees vs. pine trees? Moreover, ecological geneticists ask whether the effects of an environmental variable depend on the genotype. Effects of a factor may also depend on the levels of another factor - in other words, for a given species, 2 factors may show a dependency on the levels of each other; an ‘interaction', in a statistical sense. For example, does the effect of CO2 depend on the level of acid precipitation? Why? At a high CO2 level, a plant may gain more carbon through photosynthesis and be better able to withstand the negative effects of acid precipitation than when CO2 levels are low. All of these examples show that we cannot readily predict the consequences of global or regional environmental change without explicitly designing experiments that includes different species or genotypes, or examine two-factor effects on a species. Proposed studies should address the possible importance of two-way interactive effects (species x factor, genotype x factor, or factor x factor). The BSF is interested in supporting research using either model systems OR representatives of native species for which environmental change is a particular concern. It will not be possible to work with vertebrate species due to animal care protocol requirements which cannot be met in the time-frame of this course. Within these broad parameters, investigators are free to propose a study of virtually any environmental factor(s) changing or presenting a stress in the present environment for certain organisms. Your research advisor may narrow your choices slightly by choosing a 'theme' for your lab section. Priority will be given to those proposals that have an explicit and well-thought-out rationale for examining particular species, genotypes, or factors. Investigators are particularly encouraged to use well- chosen 'species' or 'genotypes' as one of the factors. Please see proposal review criteria for further details on how to maximize your chances of funding. II. Proposal Outline Guidelines A. Format Proposal outlines should be comprised of a one-page description of your planned project, including: (A) Tentative Title of proposal (B) Names of Principal Investigators (P.I.s); Triad #; Name of TA (C) Statement of the question being addressed (D) Statement of why this question is important (E) What species (or community or soil or ecosystem) will you use as your experimental system? (F) List the independent variables (i.e., 'factors') in your experiment (G) List the planned 'levels' of each factor (H) List the dependent variables you plan to measure on your target organism (or system) (I) State what the implications of your findings could be (J) Seed germination / plant propagation requirements. (K) References; give at least one reference on your topic from the scientific literature B. Criteria for judging proposal outlines. •Title should adequately describe the project, including the factors and organism/system to be investigated. •Names of P.I.s/TA/Triad Number should be included. •Question statements. The questions should clearly address the potential for an interactive effect' between the two factors being varied in the experiment. 10 pts •The 'Why Is This Important' justification for the question. It should be clear how the question addresses a novel problem and why the question is an interesting one. 10 pts. •Experimental system/species. The species to be used must be (a) practical for experimental study, (b) affordable for TSE program, (c) easy to cultivate/grow/raise, (d) relevant to the question being addressed. 10 pts. •Independent variables. Two. It must be possible to manipulate them independently. They must be practical for inexpensive manipulation. They must not be dangerous or require special or expensive conditions. 10 pts. •Levels of each factor. Chosen for a reason. Span a range that may be expected to have biological effects. 10 pts. •Dependent variables. Do-able using the equipment/facilities available. Meaningful in terms of addressing the question. Practical for the organism/system of choice. 10 pts. •Significance. What are the potential implications of your expected findings? Show thought about what inferences could be made with alternative possible outcomes. 10 pts. •Seed germination / plant propagation requirements. Must explain germination /propagation process, requirements, and timeline. 10 pts. •References. Must list one scientific reference on the chosen topic. 10 pts./n Background/Introduction citations https://www.sciencedirect.com/science/article/abs/pii/B9781893997943500209 - discusses nutritional uses of sunflowers, such as benefits of sunflower oils https://www.annualreviews.org/doi/full/10.1146/annurev.environ.041008.093740 - discusses the importance of crop yield maximization as well as the importance of focusing on crop yield in the future due to growing populations https://acsess.onlinelibrary.wiley.com/doi/epdf/10.2134/agronj1988.00021962008000050 017x - Focuses on how light affects the growth of sunflower plants https://link.springer.com/chapter/10.1007/978-0-387-77594-4_6 - States the importance https://aocs.onlinelibrary.wiley.com/doi/epdf/10.1007/BF02582585 - Sunflower use in https://www.mdpi.com/2311-7524/9/10/1079 - use of sunflowers in biofuel https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8069385/ - introduction states that sunlight levels vary longitudinally and there is shorter sunlight duration in northern countries of sunflowers in world trade America https://www.annualreviews.org/doi/pdf/10.1146/annurev.py.30.090192.002525?casa_toke n=i-pF2b-zF34AAAAA%3ARJSwj_bsCK-ExJ7K6i47XtV9y8AAOVgM7mDg8C0VxyZ -yeKCOa-uPcAGh1EWm2MtKTBNThlq02w - says sunflowers are grown worldwide Introduction- MOHAMMAD Sunflower agricultural uses (sunflower oil, etc.) Issues of overpopulation and the need to maximize crop yields How sunlight varies by region and sunflowers are found in lots of regions Identifying how sunlight varies by region can help us to show why we chose sunlight as a factor; using light levels to mimic different regions with their varying levels of sunlight can help us understand how to maximize densities of sunflowers in different regions Background-GROUP EFFORT Sunflower growth stages, regions of the world, and agricultural uses https://link.springer.com/chapter/10.1007/978-1-4614-0356-2_4 - article all about sunflowers (history, background, growth, physical appearance, etc.) Related experiments on sunflower reactions to light and density (find similar studies) https://iopscience.iop.org/article/10.1088/1755-1315/752/1/012019/pdf - discusses changes in growth in sunflowers as a result of varying levels of light https://cdnsciencepub.com/doi/pdf/10.4141/cips84-084 - discusses changes in growth in sunflowers as a result of varying densities Objectives/Questions/Hypotheses- MAYA Research Plan- ABBY Number each pot 1-15 for each testing group (sunlight low density, sunlight high density, shade low density, shade high density) Put 60% shade cloths over shaded test groups Chose 60% to ensure that some sunlight still reached the plants, but enough was restricted to see adequate differences https://eyouagro.com/blog/greenhouse-shade-cloth-guide/ - talks about shade cloth percentages and when they should be used – make sure this is a reputable source Water once a week (amount not yet determined) - same amount for each sample Check weekly height and SPAD reading for 5 plants in each testing group (ruler measured in centimeters and SPAD meter) Use random number generator in week 1 to determine plants being tested to avoid bias - conduct weekly checks on these plants only in concurrent weeks to keep consistency (reduces risk of human error due to high number of samples) Height and SPAD readings will be averaged in pots containing four seedlings Citation on how SPAD readings are good indicators of photosynthesis rates https://acsess.onlinelibrary.wiley.com/doi/abs/10.2135/cropsci1995.00111 83X003500050025x?casa_token=UyhklMequ0QAAAAA:lAgiPV56Heeu QyK-s15mwjnMJxP_-6H1UBDjqfHeSz7YlnKWZ0BChejNpgihqN0uk00 nNmxAaulIrg At end of experiment, place tester plants in drying chamber and take average dry biomass of each of the five samples from each testing group (pots with four plants will be averaged to compare to pot with single plant) - ensures latent water does not modify our results Compare average dry biomass and weekly height and SPAD readings from each group Conduct p-test and determine statistical significance of results Expected Significance- TROY Seed Germination/Propagation- GROUP EFFORT/nNeed to do only Introduction part in 600-700 words double spaced Student name is MOHAMMAD Introduction- MOHAMMAD - Sunflower agricultural uses (sunflower oil, etc.) Issues of overpopulation and the need to maximize crop yields How sunlight varies by region and sunflowers are found in lots of regions - Identifying how sunlight varies by region can help us to show why we chose sunlight as a factor; using light levels to mimic different regions with their varying levels of sunlight can help us understand how to maximize densities of sunflowers in different regions Note from professor : Mohammad, We all picked sections to do and we figured introduction should be the most general so it should be the easiest to do having not been here. On ecampus there is a file labeled request for proposals under week 1 that has most of the information that you will need. If you have any questions or anything just let us knowSee Answer
  • Q5: Assessment 3 field trip re... Home: CIA Workplace Topic MyTimetable A Allocate+ Student Assessment Assessment 3 requires that you apply your understanding and critical analysis skills to address the broad topic of whether sustainable food and fibre production systems can be designed to meet the needs of an increasing population. You need to use information you have gained from two of the three field trips. In this assessment task, you are required to: 'Compare and contrast two of the agribusinesses visited during the field trips as they relate to the concepts of a managed ecosystem and sustainability principles (environmental, social and economic). Are the agribusinesses sustainable as presently operating? Use examples from the field trip and the literature to support your answer.' You should prepare a written report of around 2000 words and include some appropriate references. To remain within the recommended word count, it is suggested that you restrict your analysis of the environmental sustainability to two of the following areas. This permits a more in-depth analysis of environmental sustainability: biodiversity and stability • energy and productivity • nitrogen cycle (maintenance of fertility) • detritus cycles/soil organic carbon • the hydrological cycle (managing water resources) Note, however, that you are still required to analyse economic and social sustainability at the two agribusinesses. It will be important to take detailed notes during the field trips, for use as examples to support your analysis of the topic. Feel free to include photos in your report water resources) Mucates Student Note, however, that you are still required to analyse economic and social sustainability at the two agribusinesses. It will be important to take detailed notes during the field trips, for use as examples to support your analysis of the topic. Feel free to include photos in your report Structure You are free to structure the report in a way that makes sense to you. Two suggested ways are: 1. You could start with a section giving an overview of the two enterprises, and then compare them under headings of economic, social, and environmental sustainability 2. Or you could instead review the first enterprise under each of these headings, and then the second one, and compare the two in your conclusion An abstract or synopsis is not required for the report, but you will need to include a conclusion giving your overall perspective on how the two operations you choose compare, and whether you ultimately believe they are sustainable. Also, you could include any overall recommendations that you have for the businesses. Feel free to include photos in your report (although they won't affect your grade). Referencing Although this is a field trip report rather than an essay, you are still required to reference your sources of information. You do not have to repeatedly reference the same source - for example, you could start a paragraph along these lines: "The current owner and manager of Leap Farm, lain Field, outlined several aspects of their herd management principles as follow "and then not mention the source again until you change source Assessm ö Referencing Although this is a field trip report rather than an essay, you are still required to reference your sources of information. You do not have to repeatedly reference the same source - for example, you could start a paragraph along these lines: "The current owner and manager of Leap Farm, lain Field, outlined several aspects of their herd management principles, as follow..... and then not mention the source again until you change source. The "personal communication" mode of referencing is often used for information that is obtained verbally or not from a published source (such as information directly from the growers we met). Details on how to use this referencing type is found here . It is more common to use that for single sources within a report or paper when you are mostly using published sources. Given the field report will have a great deal of content from the farm managers we spoke to, it is OK to simply state the persons name at the start of a paragraph. Your other information sources should be used to support your content and should also be referenced (in-text citation, plus details in the reference list) using the APA 7th edition style. Assessment You can find the assessment rubric here (docx, 18.5KB), which will be used to grade your report. You will not be penalized being higher or lower than the recommended 2000 word count.See Answer
  • Q6:Device: Surgical mesh for hernia repair Small paragraph (no more than 100 words) Include figures or tables if available Make it in 80-100 words Topic: Materials used for the device Follow the ACS format for the various reference types: https://pubs.acs.org/doi/full/10.1021/acsguide.40303See Answer

TutorBin Testimonials

I found TutorBin Biotechnology homework help when I was struggling with complex concepts. Experts provided step-wise explanations and examples to help me understand concepts clearly.

Rick Jordon

5

TutorBin experts resolve your doubts without making you wait for long. Their experts are responsive & available 24/7 whenever you need Biotechnology subject guidance.

Andrea Jacobs

5

I trust TutorBin for assisting me in completing Biotechnology assignments with quality and 100% accuracy. Experts are polite, listen to my problems, and have extensive experience in their domain.

Lilian King

5

I got my Biotechnology homework done on time. My assignment is proofread and edited by professionals. Got zero plagiarism as experts developed my assignment from scratch. Feel relieved and super excited.

Joey Dip

5

TutorBin helping students around the globe

TutorBin believes that distance should never be a barrier to learning. Over 500000+ orders and 100000+ happy customers explain TutorBin has become the name that keeps learning fun in the UK, USA, Canada, Australia, Singapore, and UAE.