genetics homework help

Boost your journey with 24/7 access to skilled experts, offering unmatched genetics homework help

Trusted by 1.1 M+ Happy Students

4.4Trust Pilot

4.4Edu Reviewer

5App Review

4.8Student

WhatsApp Support

Get Instant
Online Homework Help
via WhatsApp

Get instant homework help from top tutors—just a WhatsApp message away. 24/7 hw help support for all your academic needs!

★★★★★

2M+ students trust TutorBin

Your WhatsApp Number

⚡ Instant reply

🔒 100% private

👨‍🏫 Top tutors

🌍 All subjects

^*Get instant homework help from top tutors—just a WhatsApp message away. 24/7 support for all your academic needs!

2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee

Recently Asked genetics Questions

Expert help when you need it

Q1: Semester 2, Skill 3 Part A: The Eye 1. Testing your distance visual acuity with the Snellen Chart 1. Stand 6 meters away from the chart. (For this purpose, a Snellen chart is displayed on the wall and a line is marked on the floor with a tape at a distance of 6 meters from it.) 2. Close one eye and read the lines on the chart from the top until you can no longer read the letters clearly. 3. Read off the visual acuity number on the side of the chart. Record this as a fraction, the first number being the distance from the chart in meters or feet e.g. 6/9 or 20/30 4. Repeat for the other eye, then for both eyes open together Left eye Right eye Both eyes Fraction in feet Fraction in meters 2. Using The Ophthalmoscope The ophthalmoscope is a lighted instrument used to examine the interior of the eye, including the lens, retina and optic nerve. It consists of a concave mirror and a battery- powered light (contained within the handle). The operator looks through a single monocular eyepiece into the patient's eye. The ophthalmoscope is equipped with a rotating disc of lenses to permit the eye to be examined at different depths and magnifications. This may be enhanced by drugs that dilate the pupil and enlarge the opening into the structures within the eye. Brow rest Practitioner side of the ophthalmoscope Diopter dial Viewing window Dioptre power display On/off switch GEEKYMEDICS.COM 1. Familiarise yourself with the ophthalmoscope. Check that you know how to switch it on and that the light is working. Set the value to 0 to begin (stronger lenses will be needed to inspect other parts of the eye). Use the head model with diagnostic eye trainer to practice using the ophthalmoscope. 2. Gently place your free hand on the model's head. Use your right eye to examine their right eye, and your left eye to examine their left eye. Look towards the subject's face through the aperture of the ophthalmoscope, steadying it against the side of your nose. Move the instrument around until the spot of light falls on the eye. Move your head with the ophthalmoscope (as a single unit) sideways until you see a red glow (the red reflex) from the pupil of the eye. Gradually move towards the subject until the fundus is seen (you will need to be close to the subject). You can then try to see other features by moving the dial to change focus. 3. Make observations using the head model provided. Aim to identify key features of the normal eye, then change the view to observe some different disease conditions (by changing the number on the model's controls) and make observations of notable differences. 3. If you feel comfortable using the Ophthalmoscope, practice on a real human eye. Ask your partner to sit comfortably and stare at a distant object behind you, keeping their eye open. Stand or sit in front of your partner and try to examine their eye in the same way as you did on the model trainer. Make a note of any features you manage to see. Examination of the Fundus The fundus consists of the optic disc, retina, retina vessels, maculae lutea. You may need a weak diverging lens (-2D to -4D) to focus on the optic disc and macula. Examination of other parts of the eye You will need to use converging (+ve) lenses to focus on structures anterior to the fundus. e.g. vitreous humour +4D - +8D Lens +10D Iris +15D Aqueous humour +14D+18D fovea optic nerve Cornea +20D Human retina Part B: The Ear 1. Audiometry An Audiometer is an electrical instrument used for measuring a subjects hearing. Auditory responses are monitored at different frequencies over a range of amplitudes. You will be using a screening audiometer to measure threshold in decibels at different frequencies. To produce an audiogram: a) Connect the left (blue) and right (red) jack plugs to the headphones and the jack plug (black) of the persons response button into the corresponding coloured and labelled sockets (4, 5, & 6) on the back of the panel. b) Connect the power cable to the mains input (2) on the back of the panel and to the mains supply. Turn the switch ON at the socket. The green ON indicator should light up on the front panel. Press the Right/Yes button. c) Sit the subject with his/her back to the audiometer. The subject should be told to press the response button upon hearing the tone and release it when the tone is no longer heard. d) The headset should be fitted with the RED earpiece on the RIGHT ear e) Select the "LEFT" ear position first on the earphone selector. Select 1 kHz (1000Hz) on the frequency selector and select 30 dB on the attenuator level. f) Press the "PRESENT” button for 2 secs, the green "present" button will light up. If the tone is heard, the subject should respond by pressing the response button (if there is a hearing impairment, the tone will not be heard). The attenuator level should be increased in steps of 5 dB until the tone is heard. Always release the “PRESENT” button before changing frequency or attenuation g) Once the initial threshold has been established, the attenuator level should be decreased in 10 dB steps until the tone is no longer heard and then increased in 5dB steps for the hearing threshold level to be checked h) The threshold of hearing is the lowest level at which a subject can identify the tone when it is re-introduced. Thresholds should be measure in sequences of 500Hz, 250Hz, 1, 2, 4, 6 and 8 kHz) i) Plot the threshold dB on the audiogram chart provided, for left ear thresholds mark using a small cross and for right ear use a small circle j) Repeat for the other ear 2. Parts of the ear Observe the model of the ear and try to identify the structures in the diagram below. Then, look at your partner's ear and try to identify the same structures. Finally, use the model to examine the structure of the inner ear before proceeding to the next section. Make note of your observations for your skills report. Triangular fossa Crus of helix Tragus Helix Scaphoid fossa -Crura of antihelix Concha cava Antihelix Lobule Antitragus 3. Observations with Otoscope An otoscope is an instrument which is used to look into the ear canal. The ear speculum (a cone-shaped viewing piece of the otoscope) is slowly inserted into the ear canal while looking into the otoscope. A light beam extends beyond the viewing tip of the speculum. The otoscope is gently moved to different angles to view the canal walls and eardrum. The normal eardrum appears pinkish-grey in colour and is approximately circular in shape. The first of the three small bones that transmit sound vibrations to the hearing mechanism (the cochlea) lies against the far side of the drum and can be seen through it in the upper part, like the clock handles in approximately the 12 o'clock position. Otoscope Eardrum Michael Saunders FRCS You will be called in small groups to view your own eardrum with the otoscope attached to a camera/imager. 4. Observation with Ear Diagnostic Trainer Familiarise yourself with the otoscope using the model head trainer. To safely use the otoscope: a) Gently lift the pinna (lobe) of the subject's ear upwards and backwards b) Hold the otoscope between the thumb and forefinger (like a pencil) with the back of the hand resting gently but firmly against the subject's cheek. This prevents you from pushing the otoscope too far in and harming the ear. c) The otoscope should then move in unison with the subjects head if moved. The whole tympanic membrane cannot be seen one time so the examiner will need to adjust his/her line of vision and the position of the speculum to observe a view of the whole membrane d) Observe the healthy eardrum first, then change the number on the model head to make observations of some other conditions If you feel confident to do so, look at your partner's ear with the otoscope. You should both be seated to do this. USE A CLEAN SPECULUM FOR EACH EXAMINATION. 5. Observe the Models of the teeth. A model of the teeth and mouth has been provided. Examine the model and make observations for your written lab report.See Answer
Q2: GENE4003 SEM-1 2024 GENE4003: WORKSHEET TOPICS SET 3 AND 4 1. In Drosophila melanogaster, loss of Bicoid (bcd) results in an embryo with two tails. The bcd mutation is recessive and exhibits a maternal effect. In the cross shown below, what will be the genotypes AND phenotypes of the resulting embryos, and in what ratios? Explain your answer. bcd-/bcd (female) X bcd+/bcd (male) 2. The diagram below illustrates the normal expression of three different groups of genes (A, B, and C) within four different whorls of a developing flower. Normally, whorl 1 produces sepals, whorl 2 produces petals, whorl 3 produces stamens, and whorl 4 produces carpels. Furthermore, expression of class A genes inhibits class C genes, and expression of class C inhibits class A. B A C Whorl 1 (Sepals) 2 3 4 (Petals) (Stamens) (Carpels) What kind of mutation would produce sepals in whorls 1 and 4 and petals in whorls 2 and 3? Explain your answer. 3. "Cells of multicellular organisms become increasingly specialised as they head towards their ultimate cell fate." What kinds of experiments support this statement, and how do their results support it? 4. Describe the epigenetic changes that occur in cells during development and the role they play in differentiation of cell types within a multicellular organism. 5. Fill in the blanks in the following text about early Drosophila development with appropriate words or phrases. During oogenesis, (1)_ is synthesized in the (2)_ and transported to the pole of the egg. After fertilization, _(4)_ forms a concentration gradient that is highest at the (5) pole and lowest at the _(6)_ pole. This graded distribution of (4)_ acts as a providing (8)_ to the embryo. - In the early stages of development, (10) _ is (4)_ (4)_ activates target genes that direct the formation of the (9) axis. One of the activated target genes of _(4) _ is (10)_, which is expressed in a gradient that (11) the gradient of (4) In mutants that lack _(4)_ not sufficiently (12), and the embryo develops _(14)_ the expression of _(10), which in turn embryo. (13). This suggests that helps to specify the (15) of the 1 GENE4003 SEM-1 2024 6. You are a researcher trying to understand the epigenetic mechanisms of queen bee development. Which of the following experimental manipulations would probably not lead to the development of a queen bee? a) Feeding royal jelly to a female honeybee larva b) Feeding decitabine, a DNA methyltransferase inhibitor, to a female larva c) Injecting Dnmt3 siRNA into a female honeybee larva d) Activation of a DNA cytosine deaminase enzyme in a female larva e) Feeding royal jelly to an adult worker honeybee. 7. The composite image below shows three strains of Arabidopsis thaliana. In the diploid state, A. thaliana has two homologous sets of five chromosomes (2n = 10). a) Derive the chromosome equations for the diploid, tetraploid and octaploid strains, assuming autopolyploidy. b) Using the image, describe the relationship between ploidy, leaf size (A) and cell size (B) in this species. c) What conclusions can you draw about potential for improving crop yield by increasing ploidy levels? A C The first foliage leaf 1 mm C Diploid Tetraploid Octaploid B 0.1 mm 8. Explain how DNA methylation is passed on to daughter cells. 9. Explain how bisulfite sequencing helps researchers to detect methylated cytosines. 2 GENE4003 SEM-1 2024 10. The platypus is one of the few extant monotremes, a group of egg-laying mammals that is sister to placental mammals that bear live young. Humans and mice have two genes (Hoxa 7 and Hoxb7) with close homology to the homeobox gene Ultrabithorax in Drosophila melanogaster. A researcher interested in the function of Hox genes in the platypus is comparing two hypothetical gene phylogenies of Ubx homologues from humans, mice, platypus and Drosophila. These are shown below and labelled as Phylogeny A and Phylogeny B. Phylogeny A Hoxa7 (human) Phylogeny B Hoxa7 (human) Hoxa7 (mouse) Hoxa7 (mouse) Hoxb7 (human) Hoxa7 (platypus) Hoxb7 (mouse) Hoxb7 (human) Hoxa7 (platypus) Hoxb7 (mouse) Hoxb7 (platypus) Hoxb7 (platypus) Ubx (Drosophila) Ubx (Drosophila) a) In terms of the relative timing of putative gene duplication events during the evolution of mammals, describe how these two phylogenies differ. Your answer should identify the number of gene duplications and in what lineages they are predicted to have occurred, and should refer to orthologues and paralogues. b) Which phylogeny is most parsimonious, and why? 3See Answer
Q3:Directions: Write a well-developed academic essay (2½- 3 pgs., 500 words minimum) than analyzes and reports on the views of your classmates on the topic of genomics and genomic sequencing. The essay must include: ⚫ at least 5 paragraphs 。 with an introduction (with a thesis statement that indicates the content and organization of the essay) • 3 well-developed body paragraphs (the first body paragraph presents your background of genomic sequencing,; the second body paragraph addresses circumstances under which your classmates were most likely to agree on the use of genomic sequencing, and the third body paragraph addresses circumstances and issues that were the most divisive among your classmates on the subject of genomic sequencing) o a conclusion paragraph, in which you summarize your classmates' general outlook for the future of genomics and genomic sequencing. • at least one paraphrased source with an APA in-text citation from either reading 3 or 4 in Making Connections 4, Unit 2, that supports a point in your essay ⚫the APA reference citation under the title "List of References" at the end of the essay.See Answer
Q4: Lab 3- Meiosis and Trait Inheritance Overview This lab will introduce students to the purpose of meiosis. Students will also learn how chromosomes segregate according to Mendelian laws. Learning objectives By the end of this lab, students will be able to: State the purpose of meiosis Differentiate mitosis and meiosis Explain the difference between haploid and diploid cells Describe key events that occur in the stages of meiosis I and meiosis II Learn to compute a Punnett square ● Exercise 1: Fertilization A. Comparing Mitosis and Meiosis The diagrams in Figure 1 show mitosis and meiosis after DNA has been replicated and wound tightly into sister chromatids. The dotted lines represent cytokinesis. Figure 1. Mitosis and meiosis Pa A Pril Sex B sex D Activity A questions 1. In Figure 1, which column shows meiosis and which column shows mitosis. Meiosis Click/tap to enter A or B Mitosis Click/tap to enter A or B 2. What are some similarities between cell division by mitosis and cell division by meiosis? Click or tap here to enter text. 3. Complete Table 1 to describe some important differences between mitosis and meiosis. Table 1. Differences between mitosis and meiosis Characteristic Type of cells produced Number of daughter cells Click or tap here to enter Click or tap here to enter text. text. Genetic differences or similarities between daughter cells Mitosis Number of cell divisions Meiosis Click or tap here to enter Click or tap here to enter text. text. Click or tap here to enter Click or tap here to enter text. text. Click or tap here to enter Click or tap here to enter text. text. B. Meiosis - Cell Divisions to Produce Haploid Gametes Before meiosis, the cell makes a copy of the DNA in each chromosome. Then, during meiosis there are two cell divisions, Meiosis I and Meiosis II. These two cell divisions produce four haploid daughter cells. Meiosis I is different from mitosis because each pair of homologous chromosome lines up next to each other and then the two homologous chromosomes separate. Figure 2 shows Meiosis I for a cell with a single pair of homologous chromosomes. The stripes on the chromatids of one of the chromosomes indicates that this chromosome has different alleles than the other homologous chromosome. Meiosis I will produce daughter cells with half as many chromosomes as the parent cell, so the daughter cells are haploid. Each daughter cell has a different chromosome from the original pair of homologous chromosomes. Activity B questions Examine Figure 2 which shows a diploid cell (2n) with a pair of homologous chromosomes. After completing meiosis I, the resulting cells each contain one chromosome and are now considered haploid (n). Figure 2. Meiosis I X xx X 1. Do the chromosomes in the two daughter cells produced by Meiosis I have the same alleles for each gene? Explain your reasoning. Click or tap here to enter text. Meiosis II is like mitosis since the sister chromatids of each chromosome are separated. As a result, each daughter cell gets one copy of one chromosome from the pair of homologous chromosomes that was in the original cell. These haploid daughter cells are the gametes. 2. Use asterisks (*) to indicate the cells in Figure 3 that represent sperm produced by meiosis. Figure 3. Meiosis II Ⓒ O C. Meiosis and fertilization Almost all the cells in your body were produced by mitosis. The only exceptions are the gametes - sperm or eggs - which are produced by a different type of cell division called meiosis. During fertilization the sperm and egg unite to form a single cell called the zygote which contains all the chromosomes from both the sperm and the egg. The zygote divides into two cells by mitosis, then these cells each divide by mitosis, and mitosis is repeated many times to produce the cells in an embryo which develops into a baby (Figure 4). Figure 4. Meiosis and fertilization mother's cells meiosis↓↓ egg father's cells meiosis↓↓ fertilization zygote repeated mitosis↓↓ embryo's cells repeated mitosis ↓ baby's cells sperm Activity C questions 1. Each cell in a normal human embryo has 23 pairs of homologous chromosomes, for a total of 46 chromosomes per cell. How many chromosomes are in a normal human zygote? Explain your reasoning. Click or tap here to enter text. 2. What would happen if human sperm and eggs were produced by mitosis? Explain why this would result in an embryo, which had double the normal number of chromosomes in each cell. Click or tap here to enter text. A human embryo with that many chromosomes in each cell would be abnormal and would die before it could develop into a baby. So, gametes cannot be made by mitosis. For questions 3 and 4, click or tap number to enter the correct number. 3. Each human sperm and egg should have number_chromosomes, so fertilization will produce a zygote with number_chromosomes. This zygote will develop into a healthy embryo with number chromosomes in each cell. 4. Each sperm and each egg produced by meiosis has only one chromosome from each pair of homologous chromosomes. When a sperm and egg unite during fertilization, the resulting zygote has number pairs of homologous chromosomes. For each pair of homologous chromosomes in a zygote, one chromosome came from the egg and the other chromosome came from the Click or tap to enter text.See Answer
Q5: BIOL300 Laboratory Lab 5.1 - Analysis and Discussion: Ceratopteris Experiment Initial Understanding 1) What is the name of the substance that Ceratopteris spores secrete into the environment and what effect does it have on developing gametophytes? Recall that each spore has the genetic ability to develop into either a male or a hermaphrodite. Results Name: 2) How do we expect the concentration of the secreted substance to vary among the treatments? Why? 3) With reference to the Excel sheet of student data, complete Table 1. Table 1. Results from analysis of raw class data by treatment type. Treatment Expected number of (%) Observed mean number of gametophytes per plate gametophytes per plate. Recall that the original 100% stock solution of spores contained 2.77 spores/μL and 75 μL was applied to each plate Observed minimum and maximum number of gametophytes per plate 3.13 6.25 25 100 Lab Section: Estimated density of mean number of gametophytes per plate (60 mm diameter), expressed as gametophytes/cm² Lab 6.1 Page 1 of 2 Observed mean proportion of hermaphrodites in the gametophyte population, expressed as a decimal number, (e.g. 0.67) 4) Averages (Table 1) are a notoriously poor way of looking at a range of data values because they obscure variation in the original observations that may be scientifically meaningful. Using Excel, create a scatterplot graph of the observed gametophyte density (gametophytes/cm²) (X-axis) against the proportion of hermaphrodites (Y-axis) for each student observation. Describe the general trend of the data. 5) Using the statistical functions in Excel, provide the slope of this line (SLOPE=) and its R² value (RSQ=) as estimated from the X & Y values specified in Question 4. BIOL300 Laboratory Name: Discussion 6) The Polka Dot mutation is also known to cause weakened walls of the spore, which are more likely to break during the plating process and kill the gametophyte before it sprouts. Use a Chi-Square test to determine if there is a statistically significant departure in the expected 1:1 ratio of Wildtype to Polka Dot genotypes among our surviving hermaphrodites. Use the Chi-Square Goodness of Fit Calculator at http://www.socscistatistics.com/tests/Default.aspx). Row 1 and Row 2 are labeled by genotype, Column 1 and Column 2 report Observed and Expected values. Test Statistic p-value Lab Section: Is this significant at the 0.05 level? 7) Assuming there was 100% spore germination, how accurate were students in their ability to pipette the expected number of spores for each treatment? Explain and defend your explanation using results from Table 1. 8) Each spore has the ability to develop into either a male or a hermaphrodite, so why is there a density dependent trend? In your answer, described how the observed proportion of hermaphrodites changes as a function of gametophyte density and what may have caused this trend. 9) What advantage could there be to individual gametophytes that produce the hormone? 10) Was there difference in the survivorship between the two genotypes (wild type and polka dot), at least among the hermaphrodites? Lab 6.1 Page 2 of 2See Answer
Q6:Verbal-modern-Day Evolution name: Date: P: Malaria, being the #1 killer of humans in the history of our species, is of grave concern, especially in tropical arears. Malaria is transmitted to humans via mosquito bites. Unfortunately, mosquitoes are becoming resistant to insecticides, using a resurgence in malaria. Investigators wondered whether alleles encoding resistance to insecticides have been sferred between closely related species of Anopheles. The analysis of DNA can detect the transfer of resistance alleles between closely related mosquito species. To find out whether such transfers have occurred, DNA was analyzed from two species of mosquitoes that transmit malaria (Anopheles gambiae and A. coluzzii) and from A. gambiae x A. coluzzii hybrids. A. gambiae +/+ +/+ +/ r/r Pre-2008 4 6 3 2008 7 7 6 Post-2008 4 4 54 Hybrids +/+ +/n r/r 2008 9 6 0 A. coluzzii +/+ +/r T/T Pre-2008 2008 229 0 0 68 6 0 80 124 92 Post-2008 Table 1: Genotype data of the Anopheles mosquitoes. Resistance to DDT and other insecticides in Anopheles is affected by a sodium channel gene, kdr. The r allele of this gene confers resistance, while the wild type (+/+) genotype is not resistant. Researchers sequenced the kdr gene from mosquitoes collected in Mali during three time periods: pre-2008 (2004 and 2006), 2008, and post-2008 (2011–2014). A. gambiae and A. coluzzii were collected during all three time periods, but their hybrids only occurred in 2008, the first year that insecticide-treated bed nets were used to reduce the spread of malaria. A likely explanation is that the introduction of the treated bed nets may have briefly favored hybrid individuals, which are usually at a selective disadvantage. A. gambiae Pre-2008 2008 Post-2008 A. coluzzii Pre-2008 2008 Post-2008 +/+ +/+ +/r r/r r/r +/r Table 2: Genotype frequencies of the different genotypes of the Anopheles mosquitoes. 1. State the null and alternative hypothesis of the scientists. Null: Alternative: 2. [SP4] Complete the second table by calculating the genotype frequencies in each species for each time period. 3. [SP5] Describe the change in kdr genotype frequencies over time in A. gambiae. Propose a hypothesis with explanation to account for the observation./n4. [SP5] Describe the change in kdr genotype frequencies over time in A. coluzzii. Propose a hypothesis with explanation that accounts for the observation. 5. [SP5] Explain whether the data indicate that hybridization can lead to the transfer of adaptive alleles. Provide reasoning for your answer. 6. [SP6] Predict how the transfer of the r allele to A. coluzzii populations could affect the number of malaria cases in the years immediately following the transfer.See Answer
Q7:A) Analysis of gene X (20 Marks) The following DNA sequence has been identified and named 'gene X'. It is thought that this sequence codes for a single protein. Design 5' and 3' PCR primers that will amplify ONLY the open reading frame of the genes. Give these sequences in a 5' to 3' orientation. Include PstI and SacI restriction enzyme recognition sites on the 5' ends of the 5' and 3' primers respectively. Provide an accurate PCR program that will amplify the sequence based on the primers you designed. Provide the amino acid sequence of the protein encoded by the gene. Provide details of the theoretical molecular weight and isoelectric point of the protein. Use your bioinformatics skills to provide details of the TM regions of the proteins. Name the protein and provide a brief description of its role in health and disease. Remember to label figures appropriately and provide figure legends. > Gene_X CGCGCGCTGCCTGAGGACGCCGCGGCCCCCGCCCCCGCCATGGGCGCCCCTG CCTGCGCCCTCGCGCTCTGCGTGGCCGTGGCCATCGTGGCCGGCGCCTCCTCG GAGTCCTTGGGGACGGAGCAGCGCGTCGTGGGGCGAGCGGCAGAAGTCCCG GGCCCAGAGCCCGGCCAGCAGGAGCAGTTGGTCTTCGGCAGCGGGGATGCTG TGGAGCTGAGCTGTCCCCCGCCCGGGGGTGGTCCCATGGGGCCCACTGTCTG GGTCAAGGATGGCACAGGGCTGGTGCCCTCGGAGCGTGTCCTGGTGGGGCCC CAGCGGCTGCAGGTGCTGAATGCCTCCCACGAGGACTCCGGGGCCTACAGCTSee Answer
Q8:NOTE Work is all to be done via a simulation software that need to download and install and access the workbook from there. ◆ Need a mac os software to install software ◆ LINK FOR WORKBOOK https://acrobat.adobe.com/id/urn:aaid:sc: VA6C2:d85874da-c076-48f2-bdd0-d9ae1010a5a2 After downloading and install the software Then switch location setting to Canada for it to work ◆ dmg file is uploaded install and do simulation and Fill out answers/nExercise 2: Sickle Cell Alleles In the sickle cell allele exercises, you will simulate the population genetics of the sickle cell gene in relation to the occurrence of malaria in several parts of Africa. To complete these exercises, you will use SimBio simulation software and an accompanying workbook, which you will access online. The workbook that comes with the software provides the theoretical background for the activities and the questions that you will complete and submit to my Tutor for grading. Time requirement: This simulation exercise takes about three hours. The activities are broken down into five exercises, each of which can be done independently. Please submit the answers to the questions for all five exercises in the text file derived from the original workbook. Note: In some instances, you may need to include tables or diagrams in your answers. In addition, submit the answers to the ten graded questions online. You will find these questions as a separate item with the exercises in the software package. There is a graded question and a written portion, and both need to be provided./n SimBio Virtual Labs® EvoBeaker®: Sickle-Cell Alleles NOTE TO STUDENTS: This workbook accompanies the SimBio Virtual Labs Sickle-Cell Alleles laboratory. Only registered subscribers are authorized to use this material. Laboratory subscriptions may not be shared or transferred. Student's Name: Signature: Date: This and other SimBio Virtual Labs are accessible through SimBio's SimUText System". This workbook or any portion thereof may not be reproduced or used in any manner without the express written permission from the copyright holder. Students purchasing this workbook new from authorized vendors are licensed to use the associated laboratory software; however, the accompanying software license is non-transferable. simbio VIRTUAL LABS SimBio Virtual Labs®: EvoBeakerⓇ Sickle-Cell Alleles A WARNING FROM SIMBIO ABOUT CHEATING You should know that, among other things, we periodically tinker with the underlying models in our simulations so that the results they produce (i.e. the "right answers") change, and we let instructors know how to recognize cheating. We hope you do not succumb to the temptation but, instead, go ahead and dive in. We've tried to make it a truly interesting experience and a fun way to learn. Introduction Malaria is one of the world's most serious diseases, infecting upwards of 300 million people and killing one and a half million people each year. It is most common in Africa but occurs in warmer climates worldwide. People are infected when bitten by mosquitoes carrying certain kinds of protozoa. The malarial protozoa are released as the mosquito's mouth parts pierce the skin of the unlucky victim. The protozoa then swim through the victim's blood until reaching the liver. There they reproduce and emerge to infect the host's red blood cells, after which another mosquito can suck them back up and start the cycle over again. Just about anything that would protect people from malaria would be beneficial for those who live in the malaria-prone areas of the world. And indeed, some people carry an allele of a gene that provides just such a defense. Surprisingly, this anti-malaria allele was tracked down through studies of a seemingly completely unrelated disease: sickle-cell anemia. Sickle-cell anemia is every bit as nasty as malaria. Individuals with this disease have red blood cells that curve into a sickle shape instead of remaining in the circular doughnut shape of normal red blood cells. The sickle-shaped cells tend to get stuck in small blood vessels, blocking blood flow, and halting the supply of oxygen to downstream cells. Unlike malaria, sickle-cell anemia is a genetic disease. Individuals inherit alleles that cause the disease from their parents. Sickle-cell anemia is associated with a gene that encodes part of the hemoglobin molecule (called the Hb gene). Hemoglobin is the protein in red blood cells that carries oxygen. The © 2022, SimBio. All Rights Reserved. 1 SimBio Virtual Labs | Sickle-Cell Alleles allele for the normal hemoglobin protein is called HbA and the allele for sickle cell anemia is called HbS. People who inherit the HbS allele from both parents (i.e., have the "homozygous" genotype HbS/HbS) have a form of hemoglobin that makes their red blood cells highly prone to becoming sickle-shaped. People who inherit one sickle-cell and one normal hemoglobin allele (i.e., have the "heterozygous" genotype HbS/HbA) can experience health effects but often the effects are so minor that these people do not realize they carry the HbS allele. Although people with sickle-cell anemia typically die from the disease before they are old enough to reproduce, it is relatively common in some parts of the world. Why doesn't natural selection eliminate the disease gene? The answer is that although the sickle-cell allele can cripple your red blood cells, it can also protect you against malaria. Having one copy of HbS (the sickle-cell allele) protects you from becoming sick from malaria. Heterozygous (HbS/HbA) red blood cells that become infected with the malaria protozoa will sickle. The body's immune system recognizes that something is wrong with the sickled cells and disposes of them. So anyone who is heterozygous for the sickle-cell hemoglobin allele is protected from both malaria and sickle-cell anemia. In genetics lingo, this is an example of a case of "heterozygote advantage." © 2022, SimBio. All Rights Reserved. 2 SimBio Virtual Labs | Sickle-Cell Alleles Some Important Terms and Concepts Population Genetics The study of how the genes in populations change over time. Genes, Loci, Alleles, and Gene Pools: A Quick Review of Terms Genes are units of hereditary information composed of DNA (or sometimes RNA) sequences. Genes are found on chromosomes. The place along the chromosome where the gene is located is called the locus (plural=loci). Population geneticists often refer to genes as "loci". Alleles are alternate versions of genes (they have different DNA sequences which may or may not code for different proteins). The total collection of genes in a population is called a gene pool. Population geneticists often focus on subsets of gene pools, such as all of the alleles at a particular locus. The Hardy-Weinberg Equation In 1908 an English mathematician (G.H. Hardy) and a German physician (W. Weinberg) independently developed a formula that can be used for estimating allele frequencies from genotype frequencies or to estimate genotype frequencies from allele frequencies (for sexually-reproducing organisms). The formula: p²+2pq+q² = 1 commonly referred to as the Hardy-Weinberg equation, applies when there are two alleles of a gene. The frequency of one allele is designated p and the other is designated q. The first part of the equation (p²) gives the frequency of homozygotes of the first allele, the middle part (2pq) gives the frequency of heterozygotes, and the third part (q²) gives the frequency of homozygotes of the second allele (note: sometimes these are referred to as "Hardy-Weinberg proportions"). If you know any one of the three parts, you can deduce the other two because p + q = 1 (and thus p=1-q and q=1-p). For example, if you know the frequency of homozygotes for the first allele in a population (perhaps because all homozygotes for that allele have a distinctive trait), then you know p². By taking the square root of that, you get p and by subtracting that value from 1 you get q. Once you know p and q, you can then plug those numbers into the Hardy-Weinberg equation to figure out the expected frequency of heterozygotes (2pq) and homozygotes for the second allele (q²). © 2022, SimBio. All Rights Reserved. 3 SimBio Virtual Labs | Sickle-Cell Alleles The Hardy-Weinberg Theorem and Hardy-Weinberg Equilibrium The Hardy-Weinberg equation resulted from Hardy and Weinberg applying probability theory to basic Mendelian genetics. Theoreticians often apply certain "assumptions" in their models to simplify the underlying mathematics. Hardy and Weinberg assumed that populations are very large and that there is no immigration or emigration. They also assumed that individuals mate at random to produce the next generation. Given these conditions, and no mutations or selection, there will be no evolution, and populations will be at what is known as "Hardy-Weinberg equilibrium". The frequency of any allele in a population will be the same as the frequency of that allele in the haploid gametes (the eggs and sperm) and all that will happen from one generation to the next is that the alleles will be randomly shuffled and sorted again into pairs. Given this scenario, the probability of the various combinations of alleles (genotypes) will depend entirely on the allele frequencies. One way to think about the Hardy-Weinberg theorem and Hardy-Weinberg equilibrium is to imagine a system in which alleles (e.g., A and a) are drawn in pairs from a pot. The pot contains the same allele frequencies as were present in the previous generation. This pot automatically replaces what is drawn from it so that the allele frequency composition remains constant. Applying probability theory, the chance of producing a genotype is the probability of drawing the first allele times the probability of drawing the second allele. If we substitute in p for the frequency of A and q for the frequency of a, the probability of A/A will be (p)(p) = p². The probability of A/a will be (p)(q) and of a/A will be (q)(p) so the probability of a heterozygote (A/a or a/A) will be (p)(q)+ (q)(p) = 2pq. The probability of a/a will be (q)(q) =q². The three probabilities must add up to 1 so p²+2pq+q² = 1. This is how Hardy and Weinberg derived their famous equation. Deviations From Hardy-Weinberg Equilibrium: Natural Selection and Genetic Drift As described in the previous section, the Hardy-Weinberg theorem applies to large, random-mating populations that do not experience mutation, migration, natural selection, or random genetic drift. Given that many populations in the real world probably don't conform to those rules, you might onder about the utility of the Hardy-Weinberg theorem. The power the Hardy-Weinberg eorem is that it allows us to quantify our expectations of what would happen in populations if evolution were not occurring, which allows us to compare those expectations to what we see in real populations. For example, if we suspect natural selection is acting on a particular allele or genotype in a population, we can determine allele and/or genotype frequencies in the population in one generation and then see how well the frequencies conform with the expectations of Hardy-Weinberg equilibrium in future generations. If the frequencies are not very different than the expected Hardy-Weinberg proportions, © 2022, SimBio. All Rights Reserved. 4See Answer
Q9:[6] Complete the Punnett square below when the parents are BB and Bb. Punnett Square Female Alleles/Genes B (from Bb) b (from Bb) Male B from BB BB Bb B from BB BB BbSee Answer
Q10:[5] What evidence from this data run supports the hypothesis that the B allele is heterozygous dominant? Explain your reasoning.See Answer
Q11:[3] Why are there no BB baby bugs or bb baby bugs from this data run?See Answer
Q12:Lab Report 2: PCR and qPCR REMINDER: We do not want either a repeat of the Lab Manual or a repeat of everything you recorded in your Lab book. (Marks will be deducted for failing to adhere to this.) 1. Briefly describe the steps involved in a Polymerase Chain Reaction. 2. Attach a properly labelled photograph of amplicons from PCR. Estimate the sizes of any "bands" or size range of any "smears" that can be discerned from the Ladder. 3. Present a table of your NanoDrop quantification of "purified PCR products". Comment on the yield and the purity of samples. Be sure to address any anomalies. 4. Briefly describe the "Types" of qPCR used to quantify gene expression. Comment on the type of qPCR you have used to quantify the expression of your gene of interest. 5. Provide a table of your qPCR data analysis and present the results in a bar diagram with proper labeling. 6. Summarize the results from your qPCR experiment. Comment on whether these results reinforce or contradict your initial hypothesis on the expression of your gene of interest in Ras-transformed cells compared to the control cells? Additional Resources if you need them: • The sizes of the DNA fragments in the DNA Ladders are in Appendix #2.See Answer
Q13:The purpose of this weekly work is to help you recall and articulate class concepts, and to build deep understanding, long-term memory, and personal connections with the concepts. Write 4-5 sentence responses to these questions, and bring your work to class (either printed out, or be able to pull your work up electronically). This work is due in D2L Brightspace the night before class each week. Grading: Written (5 points): Full responses that show in-depth understanding, rewording of the concepts into your own words, and strong connections of the content with your own experience. In-class (5-points): Attendance and full participation discussing the concepts and your responses with a small group of peers, as well as participating in class activities that day. 1. Genes and environments interact to produce one's phenotype. Give an example from your own life of an interaction between heredity and environment influencing how you turned out. Why are there so many twin studies about this? 2. List the three stages of prenatal development in the correct order, and note how long each stage lasts. Indicate the major event that indicates the beginning and end of each stage. Share a memory or story from your life about prenatal development - state the stage, as well as the development milestone or issue. 3. Name 2 each of the following: teratogenic drugs, teratogenic diseases, and environmental teratogens. Give a hypothetical example of a woman who is exposed to a teratogen for a period during her pregnancy. State the length of exposure, and the potential consequence. Refer to the chart on page 50. 4. Talk about low birth weight newborns - how is the term defined, what can cause this, and what type of care is needed after birth?See Answer
Q14:4. Did this experiment include a positive control in the PCR or RFLP? Why is a positive control important in a genotyping assay? (3 marks)See Answer
Q15:2. What are the genotypes of the animals that you analysed. Explain how you determined their genotype and what this means for the expected phenotype of the animals (8 marks)See Answer
Q16:While studying for your molecular genetics test, your friend says that during translation, the polypeptide chain is always located in the P site of the ribosome. Is your friend correct? Refer to the process of polypeptide production in the ribosomes to explain. See Answer
Q17:Based on the strand of DNA below, determine the amino acid sequence that would be produced. Show your work! See Answer
Q18:Suppose an individual had a mutation in their gene that codes for the production of DNA polymerase I. What issues would this individual experience? Explain by referring to specific concepts learned in class. See Answer
Q19:Which prime of the deoxyribose sugar in a nucleotide forms a phosphodiester band with the phosphate group of the next nucleotide? 1 2¹ 3 5'See Answer
Q20:To which prime is the phosphate group attached to within a nucleotide? 1 2¹ 3¹ 5'See Answer

TutorBin Testimonials

I found TutorBin Genetics homework help when I was struggling with complex concepts. Experts provided step-wise explanations and examples to help me understand concepts clearly.

Rick Jordon

TutorBin experts resolve your doubts without making you wait for long. Their experts are responsive & available 24/7 whenever you need Genetics subject guidance.

Andrea Jacobs

I trust TutorBin for assisting me in completing Genetics assignments with quality and 100% accuracy. Experts are polite, listen to my problems, and have extensive experience in their domain.

Lilian King

I got my Genetics homework done on time. My assignment is proofread and edited by professionals. Got zero plagiarism as experts developed my assignment from scratch. Feel relieved and super excited.

Joey Dip

Popular Subjects for genetics

You can get the best rated step-by-step problem explanations from 65000+ expert tutors by ordering TutorBin genetics homework help.

TutorBin helping students around the globe

TutorBin believes that distance should never be a barrier to learning. Over 500000+ orders and 100000+ happy customers explain TutorBin has become the name that keeps learning fun in the UK, USA, Canada, Australia, Singapore, and UAE.