biology homework help

Boost your journey with 24/7 access to skilled experts, offering unmatched biology homework help

Trusted by 1.1 M+ Happy Students

4.4Trust Pilot

4.4Edu Reviewer

5App Review

4.8Student

WhatsApp Support

Get Instant
Online Homework Help
via WhatsApp

Get instant homework help from top tutors—just a WhatsApp message away. 24/7 hw help support for all your academic needs!

★★★★★

2M+ students trust TutorBin

Your WhatsApp Number

⚡ Instant reply

🔒 100% private

👨‍🏫 Top tutors

🌍 All subjects

^*Get instant homework help from top tutors—just a WhatsApp message away. 24/7 support for all your academic needs!

2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee

Recently Asked biology Questions

Expert help when you need it

Q1:Question Write a short essay (300 words each). Please discuss the CRISPR/Cas systems, their roles in nature, and the ways that they can be used to improve human health Please discuss the roles of DNA-binding proteins in genetic regulation Instructions: Answer all the questions following the instructions. Strictly do not use AI for solving questions. The solution should be free of Plagiarism. Solution to be formatted in APA and use appropriate references with in-text citations in APA.See Answer
Q2:Question Write a short essay (300 words each). Please discuss the various types of programmed cell death and how this is accomplished. Please discuss the role of p53 in sensing and repairing DNA damage. Instructions: Answer all the questions following the instructions. Strictly do not use AI for solving questions. The solution should be free of Plagiarism. Solution to be formatted in APA and use appropriate references with in-text citations in APA.See Answer
Q3:Question Write a short essay (no more than 350 words) about each. Please compare and contrast transcription in prokaryotes and eukaryotes Please compare and contrast translation in prokaryotes and eukaryotes. Remember that compare and contrast means: tell me what they have in common, and what their key differences are. Instructions: Answer all the questions following the instructions. Strictly do not use AI for solving questions. The solution should be free of Plagiarism. Solution to be formatted in APA and use appropriate references with in-text citations in APA.See Answer
Q4:1. Cellular transport- Compare various transportation mechanism with appropriate examples (Active transport, passive transport (simple and facilitated diffusion)See Answer
Q5:INSTRUCTIONS Topic: "Stem cell and genetic engineering" He needs 500 words paper stem cell and genetic engineering with references. 500 words APA You can use external resources for the workSee Answer
Q6: Based on W.H. Heidcamp Edited by C. Antonescu, R. Botelho and L. Victorio 1. 2. 3. 4. 5. 6. 7. 8. Laboratory 1 The Light Microscope and Image Analysis Learning Objectives Properly care for and confidently use a bright field microscope. Identify parts of a bright field microscope and understand their function. Set up the microscope. Focus on a specimen at each magnification: 4x, 10X, 40X and 100X. Use proper technique with oil immersion lens. 9. BLG411 Cell Biology II Lab Capture digital images Employ software (ImageJ) to analyse image data. Employ numerical analysis software to obtain statistical relevant information and build graphs representing data (eg. Excel, Prism) Employ multimedia software to generate a figure comparing data (eg. Powerpoint, Adobe Illustrator). 10. Learn the basics of micropipetting Experimental Objectives 1. Use a light microscope to observe fixed cells. 2. Develop micropipetting technique 3. Compare and identify differences between wild-type yeast and fab1▲ mutant yeast. 4. Use simple tools in image analysis software to quantify cellular features Laboratory Exercises Exercise 1.1 The Bright Field Microscope Exercise 1.2 Measurements of Cell Organelles Exercise 1.3 Micropipetting Exercise 1.4 Use of Oil Immersion (100x) Lens 1 Based on W.H. Heidcamp Edited by C. Antonescu, R. Botelho and L. Victorio NOTE: ************ ****** 1. 2. 1. All experiments are to be done in pairs. 2. All observations, drawings, and calculations are to be recorded in your lab notebook and must be completed during lab period. Your TA will need to sign your notebook at the end of the day. You will NOT receive marks if this is not done. 3. 3. You will need to acquire image data and import into an approved digital device for future analysis (USB, laptop, phone, etc.). You may need to upload these images as proof that you acquired them. BLG411 Cell Biology II Lab ******** Your lab notebook In this laboratory series, you are required to use a laboratory notebook to annotate your observations and answer questions. You may use a partitioned lab notebook for BLG411 if it is clearly labeled which section belongs to BGL411. A few comments about the notebook: ************* You should number your pages, starting with page 1 for the beginning of the partition dedicated to BLG411. For each experimental lab (Lab 1, Lab 2, etc.), you need to give: a. A lab title (as above) b. Complete date of your lab c. Use subheading like 1.1, 1.2, etc. with a title for each exercise. d. Answer the relevant questions and make the relevant observations within the relevant subheading. e. At the end of the day, your TA will need to review and initial your lab book at the last page of your annotations for each specific day. 2 f. If there are calculations, please do them all ahead of time in the flowchart and/or lab notebook You must not lose the lab notebook. Based on W.H. Heidcamp Edited by C. Antonescu, R. Botelho and L. Victorio Introduction to the Light Microscope The light microscope is a valuable tool in the development of scientific theory by enabling visualization of tiny objects through the use of magnifying lenses. Modern light microscopes are called compound microscopes because they have two lens sets; a primary magnifying lens and a secondary lens system. Light is made to pass through an object and is then focused by the primary and secondary lens. - Using these magnifying lenses, microscopes do two things: magnify and enhance resolution. Magnification is the visual enlargement of a small object (Figure 1.1). However, one can enlarge the image of an object, and obtain a highly pixelated and blurry display (i.e compare the small top panel and its progressive magnification of the left panels of Figure 1.1 — the final 100x magnified image is pixelated though it is bigger see left panels of Figure 1.1). In order for magnification to be useful, microscopes must "fill in" the extra pixels with new information that was previously condensed into the few pixels that made up the small image (compare the small top panel and its progressive magnification of the right panels of Figure 1.1 – the final 100x magnified image displays a lot of new information and structures that were not visible in the top, small image). When this happens, microscopes enhance resolution, in other words we can now observe the details and components of what looked like a small, simple object. For the human eye to see two objects as two, it is necessary that the two objects be about 0.1 mm apart when held 25 cm from the face. If they are closer than 0.1 mm, we will perceive them as a single object. Thus, if two objects are 0.01 mm apart, we cannot detect them unless we magnify an image of them by 10X. What has happened is that we have effectively altered our resolution ability from 0.1 mm to 0.01 mm through the use of a magnifying lens. We would say that our limit of resolution has changed from 0.1 mm to 0.01 mm, or inversely, our resolving power (resolution) has increased by a factor of 10. Magnification with Resolution Magnification Alone. 45X BLG411 Cell Biology II Lab 10X Figure 1.1. Magnification vs. Resolution. 3 Based on W.H. Heidcamp Edited by C. Antonescu, R. Botelho and L. Victorio If an image of a cell is magnified from 10X to 45X, the image gets larger, but not necessarily any clearer. The image on the left, in Figure 1.1, is magnified with no increase in resolution. The image on the right is magnified the same, but with increasing resolution. Note that by the time the image is magnified 10X (from 10X to 100X), the image on the left is completely unusable. The image on the right, however, presents more detailed information. Without resolution, no matter how much the image is magnified, the amount of observable detail is fixed, and regardless of how much you increase the size of the image, no more detail can be seen. At this point, you will have reached the limit of resolution of the lens. This property of the lens is fixed by the design and construction of the lens. As mentioned, the value for resolution may be determined in one of two ways. It can be measured as the smallest distance between two points, which allows us to see the points as distinct. With this measurement, resolution increases as the distance decreases - that is, there is an inverse correlation between the limit of resolution and what you actually resolve. Equation 1.1a Limit of Resolution= Equation 1.2 0.61 χλ BLG411 Cell Biology II Lab The resolution of a lens is a property of its physical properties and of the wavelength of light that is passed through the lens. The physical properties are summed up in a value known as the numerical aperture (N.A.) while the wavelength ( is determined by the color of light (also see your book, Chapter 9 for a review). N.A. = N sin 0 N.A. 4 The numerical aperture of a lens is dependent upon two parameters: i) the angle at which the light hits the lens at (the angle of incidence, also known as the cone angle) and ii) the refractive index of the glass of which the lens (see Figure 1.2). In equation 1.2, 0 is equal to half of the angle of incidence or cone angle. The cone angle can be altered by a sub-stage condenser. If the condenser is moveable, then the cone angle can be adjusted; the closer the sub-stage condenser is to the object, the greater is the cone angle. Thus, one can improve the numerical aperture (NA) and resolution by equipping microscopes with a sub-stage condenser. Based on W.H. Heidcamp Edited by C. Antonescu, R. Botelho and L. Victorio Lower magnification Ⓒ = 32⁰ Commediamark N.A. = <1.0 45 X High Dry Power Higher magnification Ⓒ = 58⁰ Cone Angle 0 100 X Oil Immersion Cone Angle N.A. = 1.3 5 BLG411 Cell Biology II Lab Immersion oil film Figure 1.2. Cone angle and numerical aperture. The ottom part is a sub-stage condenser - by moving it closer to the sample, one can increase cone angle and resolution (Source: http://www.healthtard.com/journey-to-optical-light- microscopy). The refractive properties of a lens are summed up in a measurement known as the refractive index (R.I. or N). The refractive index is a function of the bending of light from air through glass and back again. In a microscope, the glass of the lens is specially formulated to increase its refractive index. Once manufactured, however, this property cannot be changed. However, by adding oil between objective and slide, this can further improve the total refractive index (light bending) of the light path further boosting the resolution. Putting all of this to practical use, resolution can be increased in four ways: 1) increase the angle of light incidence through a sub-stage condenser; 2) the refractive index can be maximized by using specially manufactured lenses; 3) by controlling the medium through which the light travels, i.e. using oil; 4) by decreasing the wavelength of light used. For maximum resolution, all four properties must be optimized.See Answer
Q7: Ex. 14 Lactic Acid Fermentation Introduction Lactic acid fermentation has been used by humankind in food production for thousands of years. Lactobacillus, Leuconostoc, Streptococcus, and Bifidobacterium are common bacterial genera that can ferment simple sugars in food to produce lactic acid and other organic acids, influencing the flavor, nutritional content, and preservation of the foods. Fermentation is a type of metabolism the occurs in the absence of oxygen. An anoxic environment helps prevent growth of some harmful microbes that could contaminate foods, and the acidic byproducts produced during fermentation also have preservative properties. Additional ingredients are often added during fermentation that can provide seasoning and also help ensure that the culturing process is biased towards growth of fermentative microbes, and that the growth of potentially harmful contaminant microbes is prevented. Sauerkraut is a fermented food produced by immersing cabbage in salt water, and then then allowing fermentative growth of bacteria in anoxic conditions. The presence of the salt and the anoxic environment help limit the growth of undesirable bacteria and fungi. The fermentation of sauerkraut occurs through growth of a succession of microorganisms. The first colonizers are only slightly tolerant of low pH and lactic acid, and as they grow, residual oxygen is consumed and acid is produced, leading to a reduction in solution pH. As the pH drops, other bacteria that are more acid tolerant become dominant in the culture (for example, Leuconostoc mesenteroides and Lactobacillus sp.). Leuconostoc cells are described as heterolactic bacteria because they produce approximately equal amounts of lactic acid, ethanol, and CO2. Eventually, increasing acidity will inhibit growth of Leuconostoc as well, and other fermenters such as Lactobacillus sp. will begin to predominate in the sauerkraut culture. Lactobacilli are described as homolactic bacteria because they produce lactic acid as their main fermentation byproduct. Eventually, enough lactic acid from bacterial fermentation accumulates to cause full inhibition of bacterial growth, thereby allowing preservation of the sauerkraut for a long time. Preserved foods like sauerkraut were especially valuable during wintertime, when fresh produce was hard to come by. Learning Objectives Be able to describe how Sauerkraut ferments over time Why is sauerkraut prepared with salt and kept in an anoxic environment? How does pH change, and how does this influence the succession of bacterial species? - - - Be able to describe homolactic vs heterolactic fermentation Lab Period 1 (Set up a sauerkraut culture) Materials and Supplies One deMan-Rogosa-Sharpe (MRS) agar plate: selective for Lactobacillus One Tomato Juice (TJ) agar plate: selective for Leuconostoc Anaerobic jars, pH paper, hot plate, aluminum foil, tablespoon, cutting board, knife. - Green cabbage, table salt (sodium chloride), large plastic container (~2–4 Liters) to contain the cabbage mixture. Plastic bags, to line the cabbage container. Ziplock bags, to contain macerated cabbage, water, and salt. When sealing the bag, the air in the bag should be minimized to help reduce the amount of oxygen present for the fermentation process. Balance, weighing dishes, Bunsen burner, striker, inoculating loop. Procedure 1) The sauerkraut will be prepared by your TA, with some help of some volunteers who are comfortable. Chop the cabbage into even, small pieces and put into zip-lock bags. Make sure that the zip-lock bag is open, on the scale, and tared to get an accurate reading of the weight. The lab scales can only handle up to 400 grams of weight, so don't force them to go over. Make enough bags of cabbage for at least each bench to get one and label the weight on the front of the bag. 2) After making the bags of cabbage, pass them out to the benches and start adding the salt. This style of fermentation requires 3 % (by weight) table salt to be added to the bag of cabbage. Calculate the proper amount of salt for the weight specifically written on your bag of cabbage. 3) Once you have added salt, massage and mash the cabbage until it is wilted and there is a significant amount of cabbage juice in the bag (be careful not to break the bag). This maceration process can take up to 30 minutes. 4) Once you judge that the cabbage is fully macerated, use a transfer pipette to collect about 1mL of the liquid, and add to a microcentrifuge tube. 5) Add your cabbage to the communal cabbage bucket and toss the used ziplock bag into the biohazard waste. 6) Using your centrifuge tube of cabbage juice, and correct streaking technique, streak the MRS and TJ plates. Note: MRS agar is a green/brown color and TJ agar is a dark red color. 7) Measure the pH of the cabbage juice and record in Table 14.1. This is the initial measurement for comparison to see how pH changes as the bacteria colonize the sauerkraut culture. 8) Using a loop, transfer a drop of cabbage juice to a microscope slide, and prepare a wet mount for viewing with the microscope. See Ex. 6 if you need to refresh your memory of what a wet mount is and how it is prepared. See Ex. 5 if you need a refresher on how to correctly use the microscope. 9) Write down your results in Table 14.3. Keep in mind that the sauerkraut hasn't had much time to begin the fermentation process, so consider how this may affect your observations, and predict how these observations are likely to change as the fermentation process progresses over the coming days. 10) Incubate the MRS and TJ plate in your lab section's anaerobic jar until the next lab session. 11) Your TA will place some zip-lock bags of water on top of the sauerkraut to keep as much oxygen out as possible during the fermentation process. Lab Period 2 (observations of sauerkraut fermentation) Materials and Supplies One MRS, one TJ agar plate. pH paper, micropipettes, Bunsen burner, striker, inoculating loop. Reagents for Gram staining procedure. Optical microscope with phase contrast, microscope slides, coverslips. Procedure for observing results of Lab 1 sauerkraut fermentation 1) Observe the growth on the TJ and MRS streak plates from the previous lab. Record observations (growth, colony morphology, density) in Table 14.2. Consider the reasons for growth, or lack thereof. - - 2) If you observe colonies on the plates, make wet mount slides, and also perform a Gram stain, and observe them using the microscope. If no growth occurred, skip to step 7). 3) Making wet mounts or gram stains from colonies is different from liquid cultures, because plate cultures contain a greater density of cells, requiring dilution. Start by using adding a drop of water to the slide (use the DI water from the Gram stain kit). 4) Sterilize the inoculating loop, let it cool, and then pick up a small part of a colony from the most dominant colony type on one of the culture plates. Spread the microbes in the in the water on the slide, and form a smear. Do not use an excessive amount of the colony, or the cells will be too dense to allow good visualization of individual cells under the microscope. 5) For each colony type, use this technique to make one slide for a typical wet mount (adding a coverslip to the smear), and one slide smear that you will allow to air dry for Gram staining. 6) Prepare and the observe the Gram stained slides by microscopy. Note that Leuconostoc species are Gram positive cocci that often form chains, while Lactobacillus species are Gram positive bacilli that often form chains. Make general observations, and keep in mind that it is not possible to definitively identify bacterial species from microscopy alone. 7) Record your observartions in Table 14.2, 14.3, and 14.4. Dispose of the plates from last class into the biohazard bin before moving on. 8) Check on the class sauerkraut culture to see how it is changing. As in the previous lab session, use a transfer pipette to collect about 1 mL of the fermented liquid to place into a centrifuge tube. 9) Streak some of the culture on fresh MRS and TJ plates. Incubate the plates in the anaerobic jar again until next class. 10) Measure the pH of the sauerkraut liquid, and record the results in Table 14.1. Lab Period 3 (observations of sauerkraut fermentation) Materials and Supplies - 1 MRS agar plate and 1 Tomato Juice (TJ) agar plate pH paper, centrifuge tubes, Gram staining supplies Procedure 1) Observe the streak plates from the previous lab and note differences. Again, if you have any viable colonies, prepare wet mounts and Gram stains of representative colonies and record your results in Tables 14.2, 14.3, and 14.4. Dispose of your plates from last class before moving on. 2) Use a transfer pipette to collect a sample of sauerkraut liquid to place into a centrifuge tube. Does the sauerkraut look different this time? Is it smelling different? 3) Remove a sample with your loop and streak on MRS and TJ agars. Incubate the plates in the anaerobic jar until next class. 4) Record the pH of the liquid (Table 14.1). A change in pH towards more acidic indicates that fermentation has occurred and the bacteria are producing acid. Were there any bubbles in the fermented liquid? If so, what are they from? Lab Period 4 (observing sauerkraut) Procedure 1) Examine your plates streaked from the sauerkraut culture in the previous lab session. Record results in Table 14.2. 2) Prepare a wet mount and Gram stain from colonies on each plate. Measure the pH of the sauerkraut fermentation. Record all results in Tables 14.1, 14.3, and 14.4. 3) Dispose of your plates from last class. 4) Make any final observations of how the sauerkraut has changed during the course of the fermentation./nSee Answer
Q8:(a) Draw a figure showing by what intermolecular interactions camptothecin (below) could potentially interact with topoisomerase, its target protein Camptothecin OH O [4 marks]See Answer
Q9: Results to use for your Gram Stain Data Sheet Use for #8 on your Gram Stain Data Sheet Use for #17 on your Gram Stain Data Sheet Note: The answers to question #1 must be written in the format shown on the photo; after the equal sign the answer is either pink, purple or colorless. Name Date Lab Section I was present and performed this exercise (initials) Gram Stain OBSERVATIONS AND INTERPRETATIONS 1 Record your observations in the table below. Use separate lines for different organisms found in the Gram stain of your gumiline. Include a drawing of your own epithelial cells. #8 #17 Organism or Source Cellular Morphology and Arrangement Cell include a detailed sketch of a few representative cells) Dimensions DATA SHEET 3-6 Color MCB2010Lab Gram Reaction 139 19 QUESTIONS (1 Predict the effect on Gram-positive and Gram-negative cells of the following "mistakes" made when performing a Gram stain. Consider each mistake independently. Pink, PURPLE or Colorless a. Failure to add the iodine. Gr + Gr b. Failure to apply the decolorizer. Gr + 65 c. Failure to apply the safranin. 6r+ 6r. d. Reversal of crystal violet and safranin stains. 6r+ 2)Both crystal violet and safranin are basic stains and may be used to do simple stains on Gram-positive and Gram-negative cells. This being the case, explain how they end up staining Gram-positive and Gram-negative cells differently in the Gram stain. 3 If you saw large, eukaryotic cells in the preparation made from your gumline, they were most likely your own epithelial cells. Are you Gram-positive or Gram-negative? (You can make a good guess about this even if you didn't see your cells.) 4 One of your lab partners has followed the recommended procedure of running Gram-positive and Gram-negati control organisms on her Gram stain of an unknown species. Her choices of controls were Escherichia coli an Bacillus subtilis. She tries several times and each time concludes she is decolorizing too long because both Results to use for your Acid Fast Data Sheet 1 Use for Mycobacteria on your Acid Fast Data Sheet Use for Enterococcus on your Acid Fast Data Sheet pro Namo Date Lab Section I was present and performed this exercise (initials) 1 Record your observations in the table below. Organism Enterococcus my bactria Acid-Fast Stains OBSERVATIONS AND INTERPRETATIONS Staining Cellular Morphology and Arrangement Method (include a detailed sketch PROK of a few representative cells) к FERIE K Cell Dimensions Color DATA SHEET 3-7 Acid-Fast Reaction (+/-)See Answer
Q10: Engineering Probiotics for Stress Hormone Modulation and Diabetes Management Introduction: Developing probiotics to regulate stress hormones and manage diabetes serves a cutting-edge initiative at the intersection of healthcare innovation, microbiome research, and synthetic biology. Using probiotics, researchers aim to produce bioengineered strains with the ability to regulate stress hormone levels, which have been linked to the onset and advancement of diabetes (Kandori et al., 2023). This approach makes use of the current discoveries in the field of genetic engineering to develop probiotic bacteria with enhanced properties, such as the ability to produce hormones or enzymes that regulate glucose metabolism and stress reactions (Jones & Smith, 2022). Moreover, the incorporation of probiotics into the management of diabetes exhibits potential in tackling the complex nature of the disease, providing a possible path for both prevention and treatment. This strategy could help decrease the adverse impacts of psychosocial stressors on metabolic health by regulating stress hormone levels with engineered probiotics, enhancing current therapeutic modalities including insulin therapy and lifestyle interventions (Wang et al., 2023). Probiotics' adaptability and biocompatibility are further highlighted by their use as a carrier for medicinal drugs, which allows for focused control to the gut and reduces systemic side effects (Chen et al., 2022). Furthermore, this study is in alignment with the growing body of research that shows the significance of gut microbiota in metabolic disorders, providing a basis for more individualised treatment that target the microbiota to better manage diabetes (Gupta et al., 2024). Problem Definition and justification: The growing incidence of diabetes and the adverse effects of chronic stress on metabolic health provide two major global health concerns that are intersected by the engineering of probiotics for stress hormone modulation and diabetes treatment. There may be a connection between stress and the development or worsening of diabetes, as recent studies have clarified the complex interactions between stress hormones, particularly cortisol, and glucose metabolism (Kyrou & Tsigos, 2020). Furthermore, it has been shown that dietary and stress-related disturbance of the gut microbiota has a significant role in the development of metabolic diseases such diabetes (Guo et al., 2023). Given the significant impact diabetes and its consequences—such as cardiovascular disease, neuropathy, and nephropathy-have on public health, resolving this issue is critical (American Diabetes Association, 2022). Moreover, the psychological and financial consequences of prolonged stress emphasise how urgent it is to create efficient treatments that reduce its negative impacts on metabolic health (Chrousos & Kino, 2021). Researchers aim to provide a targeted and potentially customised approach to diabetes management by creating probiotics that can modulate stress hormone levels, addressing both the physiological and psychological aspects of the condition. This study has the potential to greatly enhance the quality of life of people with diabetes by expanding the knowledge of the gut-brain axis and opening the door to novel therapeutic approaches. Research objectives: To develop bioengineered probiotics capable of modulating stress hormone levels for improved diabetes management. 1. To design genetically engineered probiotic strains that have control on stress chemicals in the gut, such as cortisol and adrenaline. 2. To examine the safety and in vitro effectiveness of the modified probiotics in regulating stress hormone levels using gut epithelium cell culture models. 3. To examine how modified probiotics might be used therapeutically to improve metabolic outcomes in preclinical models and reduce diabetes-related complications. 4. To optimise the stability, viability, and targeted distribution of designed probiotics to the gastrointestinal tract, improve formulation and delivery techniques. Methods and procedures: 1. Culture and grow a suitable probiotic host like lactobacilli or bifidobacteria on culture media and agar plates for genetic modification 2. Manipulate the host organism's genome using plasmids, restriction enzymes, PCR kits and CRISPR-Cas9 gene editing tools. 3. Clone target genes to isolate and amplify them to produce or degrade stress chemicals using cloning kits including DNA ligase, competent cells and transformation reagents. Analyze DNA fragments using gel electrophoresis. 4. Design genetic construct suitable for expression in the host by combining the target genes and regulatory elements like promoters and terminators by DNA synthesis services and plasmid design software. 5. Transform the genetic construct to the probiotic host using electroporation or bacterial conjugation kits. 6. Using selectable marker genes like antibiotic resistance genes, reporter gene assays for monitoring gene expression, and PCR to screen the transformed strains to identify those that have successfully incorporated the desired genetic constructs. 7. Characterize the engineered probiotic strains using biochemical assay kits like Cortisol ELISA Kit (e.g., Abcam) and Adrenaline (Epinephrine) ELISA Kit to confirm their ability to control the target stress chemicals. In addition to the use of genome sequencing like Illumina MiSeq, Oxford Nanopore MinIONfor to confirm genomic modifications. 8. Test the engineered probiotic strains in simulated gut model like TIM-1 (TNO Intestinal Model) to assess their efficacy and stability under conditions mimicking the human digestive system. Expected outcomes: After successfully modifying probiotics that has the potential to provide specific and tailored therapies for diabetics, addressing the physiological and psychosocial aspects of the disease. The findings of this research could result in novel treatment approaches that raise patient quality of life, decrease complications associated with diabetes, and improve metabolic results. Furthermore, this study could lead to a better comprehension of the gut-brain axis and open the door for the creation of probiotic treatments of the next generation for metabolic diseases and other stress-related diseases. Resources needed: Resources Gut cell lines Total Resources Gut cell lines Total Price Price References: Chen, Y., Zhang, L., Hong, G., & Zhang, Y. (2022). Engineering probiotics for targeted drug delivery: Recent advances and future perspectives. Advanced Drug Delivery Reviews, 179, 114036. https://doi.org/10.1016/j.addr.2021.12.013 Gupta, V. K., Paul, S., & Dutta, C. (2024). Gut microbiota: The next-gen target for therapeutic intervention in metabolic disorders. Frontiers in Endocrinology, 15, 937842. https://doi.org/10.3389/fendo.2024.937842 Jones, A. B., & Smith, C. D. (2022). Engineering probiotic bacteria for stress hormone modulation: Current progress and future directions. Trends in Biotechnology. Advance online publication. https://doi.org/10.1016/j.tibtech.2022.01.001 Kandori, K., Hirose, Y., & Nakai, K. (2023). Engineering probiotics for stress hormone modulation and diabetes management: A review of recent advancements. Journal Biotechnology, 351, 1-9. of https://doi.org/10.1016/j.jbiotec. 2023.01.001 Wang, Q., Wang, Z., Zhuang, Z., & Li, J. (2023). Engineering probiotics for diabetes management: Challenges and opportunities. Frontiers in Microbiology, 14, 702813. https://doi.org/10.3389/fmicb.2023.702813 American Diabetes Association. (2022). Economic costs of diabetes in the U.S. in 2022. Diabetes Care, 45(3), 732-742. https://doi.org/10.2337/dci22-er03 Chrousos, G. P., & Kino, T. (2021). Glucocorticoid signaling in the cell: Expanding clinical implications to complex human behavioral and somatic disorders. Annals of the York Academy of Sciences, 1518(1), 53-71. New https://doi.org/10.1111/nyas.14564 Guo, Y., Liu, Y., Zhang, Y., Liu, L., Zhang, Y., Zhang, L., Wen, W., Zhao, S., & Zhang, L. (2023). Dysbiosis of gut microbiota is closely associated with the pathogenesis of different types of diabetes mellitus. Biomedicine & Pharmacotherapy, 145, 112442. https://doi.org/10.1016/j.biopha.2022.112442 Kyrou, I., & Tsigos, C. (2020). Stress hormones: Physiological stress and regulation of metabolism. Current Opinion in Pharmacology, 50, 196-202. https://doi.org/10.1016/j.coph.2020.08.002/n Research Methodology Spring 2023- 2024 Exercise on Planning Your Research Project Prepare an outline of a project proposal which includes the following four sections. Your answers should be fairly short (a paragraph or two), with the total length of the assignment no longer than 3-4 pages. We are looking for quality of thought, not quantity. Project proposals submission will be due on Submit your assignment by e-mail. 1. Introduction: Introduce your research project using some related scientific articles and statistics. Cite the relevant references (use APA format). 2. Problem Definition (Justification) Describe the problem you plan to address and state why the intended research is important. This problem should not be too broad, but should focus on an important research question which can be addressed in your Master's Program. Cite the relevant references (use APA format). 3. Research Objectives List the objectives of the proposed research stating a one sentence general objective (or goal) and a numbered list of specific objectives. 4. Methods and Procedures Describe how the research will be conducted. Generally, what kind data will you collect and what analytical techniques or procedures do you expect to use? 5. Expected outcomes Briefly describe the expected outcomes of this proposed project. 6. Resources Needed Briefly consider the kinds of resources you will need to conduct the research (time, money, information ...) after considering the resources needed, you may need to make some adjustments in the above sections to be realistic. 7. References Format your references using APA styleSee Answer
Q11: 1. What is a receptor and why do viruses interact with receptors? B) View the data in Figure 1 below and then answer Questions 2-7 below: Figure 1: Effect of an antimicrobial peptide (AMP) on virus infection. A) Sequence of the original antimicrobial peptide (AMP37) and two peptides in which specific amino acids were mutated to either glycine (GG-48) or A) AMP37 LLGDFFKPSILKWARMWINTERSWEATERPRTESSKL GG-48 WW-48 GILKWARMWINTERSWEATERGR WILKWARMWINTERSWEATERWR +Virus Mock No Peptide AMP37 GG-48 ww-48 000 00 0.01 μM 0.1 μM 1 μM 2. What is the objective of this experiment? 3. In this experiment, what is crystal violet staining? tryptophan (WW-48). Mutated amino acids are shown in red. B) Monkey kidney (Vero) cells were incubated without or with different concentrations of AMP37, GG-48 and WW- 48 for 2 hours before infection with virus. At the time of infection cells -/+ peptide were incubated withphosphate buffered saline (PBS; mock-infection) or with virus. After 1 hour, the virus and peptide were removed, and fresh media -/+ peptide was added onto the cells. 12 Hours later, the media was removed, the cells were fixed with 3.4% formaldehyde and the stained with crystal violet. Relative levels of viral RNA 4. Why is the well of the mock infected cells purple but there is no color in the well that was incubated with virus and no peptide?) 5. Rank the antimicrobial peptides in the order of potency. 6. Explain your ranking from Question 5. 7. What do you think these peptides are targeting (the virus or the cell)? Explain your answer. View the data in Figure 2 below and then answer Questions 8-11 below: Figure 2: Effect of an antimicrobial peptide (AMP) on virus infection. 500- 400- 300- 200- 100- O Mock GG-48 WW-48 *** *** T 6 8 10 12(h.p.i) Monkey kidney (Vero) cells were incubated without or with different GG-48 and WW-48 for 2 hours before infection withvirus. At the time of infection cells -/+ peptide were incubated with phosphate buffered saline (PBS; mock-infection) or with a single-stranded positive-sense RNA virus. After 1 hour, the virus and peptide were removed and fresh media -/+ peptide was added onto the cells. At 1-, 2-, 4-, 6-, 8-, 10- and 12-hours post- infection cells were collected and the amount of virus in the cells was quantified by RT-PCR that measured levels of viral RNA and cellular GAPDH mRNA. Statistical significance was determined by student t-test when comparing mock-infection versus treatment with the antimicrobial peptides. ***P<0.0001 8. Provide a brief description of the infectious cycle of a single-stranded positive sense RNA virus from the of entry into the cell to exist. 9. In Figure 2, how are the researchers measuring infection? 10. Describe the data presented in Figure 2 in detail. 11. At what step in the infectious cycle do you think the GG-48 and WW-49 peptides are acting to restrict virus infection? Explain your answer. Virus G protein 12. What is the mechanism used by enveloped viruses to transverse a cellular membrane and enter the cell? 13. What viral protein is used for this process? 14. Draw a schematic or describe the important features of this viral protein? View the data in Figure 3 below and then answer Questions 15-19 below: + Control plasmid + ADAM17 + Furin + Cathepsin K Figure 3: Vero cells were co-transfected with a plasmid expressing the glycoprotein (G) found on the surface of Lexo Virus (LexoV), an envelope virus, and different cellular enzymes (ADAM17, Furin and Cathepsin K). Membrane fusion was examined by the formation of syncytia or multinucleated cells 24 hours post-transfection. Arrows show syncytia. 15. Describe the data in Figure 3. 16. Does the LexoV glycoprotein require a cellular cofactor for membrane fusion? Explain your answer. 17. Where in the cell are ADAM17, furin and cathepsin K localized? 18. The LexoV G protein is synthesized as a precusor potein (G0) which is then proteolytically cleaved to G1 and G2. G1 interacts with the cellular receptor and G2 mediates membrane fusion. Knowing the subcellular location of ADAM17, furin and Cathepsin K, where in the cell is G0 likely proteolytically cleaved. 19. At which cellular membrane does the G2 protein promote membrane fusion and entry LexoV? Explain your answer. A) Use Figure 4 below to answer Questions 20-25: B) LexoV-PWT LexoV-P ΔΑΒ 4.5 5 5.5 6 6.5 7 11 4.5 5 5.5 6 6.5 7 h.p.t. 11 Band intensity (normalized to maximal intensity) 1.0- 0.5- → LexoV-PWT ...LexoV-PAAB Time post-transfection (h) Ţ LexoV is a single-stranded negative-sense RNA virus that encodes N, P, M, and L proteins. Use your knowledge of the VSV replication mechanisms to help answer the questions below. 20. Which viral proteins are required for replication of LexoV? Describe the function of each of these proteins. Figure 4: The goal of this experiment was to investigate the role of an unusual domain (AB) within the LexoV P protein. In this experiment, vero cells were infected with LexoV containing either the wildtype P protein (LexoV-Pwr) or a virus in which the AB domain within P was deleted. (LexoV-PAB). At 2 hours post-infection, the normal media was removed and replaced with phosphate-deficient media, [g-23P]ATP and actinomycinD. Cells were harvested every 30 minutes from 4.5-7 hours post-infection. Total cellular and viral RNA was isolated and separated in an agarose gel, dried and exposed to a phosphorimager screen to detect the amount of newly synthesized viral RNA. A) A representataive image of the viral RNA synthesized. B) Quantification of the viral RNA at each time point. * denotes the newly synthesized viral RNA. 21. Describe the overall strategy used by single-stranded negative-sense RNA viruses to replicate the viral genomes. 22. Describe the data shown in Figure 4A. 23. Describe the data shown in Figure 4B. 24. What conclusion can be drawn from Figure 4. 25. Speculate on the function of the AB domain within the P protein. Explain the rationale for your answer.See Answer
Q12: Instructions for Final Animal Behavior Project Design an Ethogram-Based Research Project Using the Scientific Method Objectives: ● ● To understand the process of the Scientific Method. Apply the knowledge of ethograms and animal behavior to design a research project. Develop skills in formulating research questions, designing experiments, and proposing data collection methods using ethograms. To design an observational study on animal behavior using live animal cameras, incorporating an experimental variable, a control variable, and a dependent variable. Task: Design an experiment using the animal you chose for this project (from Lab 3). A. Watch the Lab 8 Power Point Presentation B. Upload a document to the Experimental Design Dropbox with your responses to the following 14 prompts: 1. Select the Study Species: Choose a species that is relevant to your research question and accessible for observation. Give the common name of the animal Give the scientific name of the animal • Genus • species 2. Determine the Observation Setting: a. Identify the appropriate setting for conducting your observations. This could be in the animal's natural habitat, a controlled laboratory environment, or a specific enclosure. b. List the website of the live cameras you would use to conduct the experiment. 3. Select Observation Methods: Determine the most suitable observation methods to collect data on animal behavior. This can include video recordings or the use of live animal cameras. 4. Define the Research Question: Clearly state the research question that you aim to address through your observations. 5. Formulate a hypothesis: Use creative thinking to combine isolated facts into a cohesive whole. It is more than a guess; it is based on existing knowledge. It must be something that can be tested (is falsifiable). The Hypothesis needs to be possible explanation for an observation. Describe what the expected behavior will be and why this behavior is happening. Use the information from your peer-reviewed literature search. 6. Define the Experimental Variable 7. Define the Control Variable. 8. Define additional control variables that will be kept constant across both groups. 9. Define the Dependent Variables: Select dependent variables that will be measured and compared between the experimental and control groups. 10. Develop an Ethogram: Create an ethogram table that lists and defines the behaviors, including the codes for these behaviors. 11. Data Collection: the duration of the observation period number of animals in each group (experimental and control. the frequency of observations any other relevant factors to ensure accurate data collection. 12. Data Analysis: Plan the data analysis methods that align with your research question and the type of data collected. This may include quantitative analysis techniques such as calculating frequencies, durations, or correlations, as well as qualitative analysis for behavioral descriptions. 13. Discussion and Conclusion: a) Reflect on the potential outcomes and their implications for the research question. b) Discuss the limitations of the study and suggest potential areas for further research. 14. Summarize your research study. • Incorporate the information you found in the peer-reviewed literature. • Minimum of 300 words. Examples of Experimental Variables that you can use to design the experiment: 1. Time of Day: The time of day can influence the activity patterns of animals. Different species may exhibit distinct behaviors during morning, afternoon, and evening. 2. Weather Conditions: Environmental factors such as temperature, humidity, and precipitation can affect animal behavior. For instance, animals may seek shelter during rain or become more active on cooler days. 3. Social Interactions: The presence and interactions of conspecifics (members of the same species) can impact animal behavior. Observing social dynamics can reveal dominance hierarchies, affiliative behaviors, and other social interactions. 4. Availability of Food: The presence and abundance of food sources in the animal's habitat can influence their foraging behavior and feeding patterns. Food availability may vary naturally, affecting the animals' activities. 5. Presence of Threats: The presence of potential environmental threats can trigger defensive behaviors and influence the animals' vigilance and movement. 6. Presence of Visitors or External Stimuli: If the animal habitat is accessible to visitors or there are external stimuli (e.g., noise, movement) from the surroundings, animals may react differently in response to human presence or disturbances. 7. Life Stage: Animals may exhibit different behaviors at various life stages, such as during infancy, adolescence, or adulthood. Observing these differences can shed light on how behaviors change as individuals age. 8. Interactions with Other Species: Observing interactions between different species, such as symbiotic relationships, competition for resources, or cooperative behaviors, can highlight the complexities of ecological interactions and species coexistence. 9. Predator-Prey Interactions: The presence of predators and their hunting behaviors, as well as the responses of potential prey species, can reveal intricate predator-prey interactions and survival strategies./n. INSTRUCTIONS ANIMAL USED IN LAB IS RED PANDA Word Limit 500 words For Whole project APA FormatSee Answer
Q13: Unit 4 Part A - Biomolecules - Guidance Title: Biomolecules and key biological principles Credits: 6 (Graded) Part A Deadline: Please use the Ascentis workbook and links provided to read on the topic to be written about and then rephrase the information into your own words. Day 1-2 1. With reference to the graph below, answer the following: a. Describe the effect of increasing substrate concentration on enzyme activity in the reaction. What happens to the rate of enzyme reaction as substrate concentration increases? b. Give an explanation for the term 'enzyme-substrate complex'. What is the role of an enzyme in a chemical reaction? What is a substrate in relation to enzymes? How do substrates and enzymes interact to form a complex? Make sure to mention the active site. c. Label 'Z' on the graph at a point where the active sites of the enzyme are not fully saturated with substrate molecules. Insert a 'Z' on the line of the graph at any point where the enzymes are not fully saturated with substrate molecules. Rate of Enzyme Controlled Reaction Substrate Concentration Day 3 2. Write a definition for each of the characteristics below Characteristic Phenotype Diploid cell Gene Locus Sex Linkage Homozygous Day 4 Definition 3. Place a tick in the corresponding boxes to link with the described features Features Contains Sulphur Is a Monomer Contains Peptide bonds Formed by a condensation reaction Is a storage molecule Contains Glycerol Day 5 Glucose Sucrose Protein Starch Fat Glycogen 4. Explain the meaning of the terms: a. Gene What is a gene and where are they located? What is the role of genes? What is the importance of genes in inheritance and traits? Give an example. b. Mutation What is a mutation and how do they occur? What is the significance of mutations in genetics? Give an example. Day 6-7 5. a. State the meaning of the term polymer. What is a polymer and how are they formed? b. Identify an energy storage polymer found in muscle cells. Name an energy storage polymer that can be found in muscle cells. c. Explain why monosaccharide molecules are not suitable as storage molecules within cells. Explain what a monosaccharide is and how they are used in the cells. Explain why monosaccharides are not suitable as storage molecules and give some examples. Resources Enzymes https://www.khanacademy.org/science/ap-biology/cellular-energetics/enzyme- structure-and-catalysis/a/enzymes-and-the-active-site https://www.youtube.com/watch?v=qgVFkRn8f10 Genetics https://www.youtube.com/watch?v=CBezq1fFUEA https://www.khanacademy.org/science/ms-biology/x0c5bb03129646fd6:inheritance- and-variation/x0c5bb03129646fd6:genes-proteins-and-traits/a/genes-proteins-and- traits-ms https://www.khanacademy.org/science/ms-biology/x0c5bb03129646fd6:inheritance- and-variation/x0c5bb03129646fd6: chromosomes/a/chromosomes-and-genes-ms https://www.bbc.co.uk/bitesize/guides/zc499j6/revision/2/nSee Answer
Q14:Build a graph that shows the average total cells per image and the average percent trypan-positive cells vs. treatment. Your column graph should have a title, y-axis and x-axis titles, each column needs to have a label. You must add standard deviation to each bar. See Appendix on Excel on how to do this. Save this graph as an image called percent trypan positive as a .jpg or .png./ntotal Treatment | Average, number of cells Average % trypan + cells. HPMI 24 Tween-20 29 0.5% Tween-20 17 3 0.1% Drug G 55 5 Drug K 24 19 0 10See Answer
Q15: le Edit View History Bookmarks Window Help v < platform.virdocs.com Purchase Lab Manu... VB Visible Body Suite VB Visible Body Course... Free Concepts of Bi... Ch. 1 Review = es & lights B cards pied ntent RedShelf. eReader The Method in Action- A Medical Example In early 2000, a disease appeared in the United States that had never been seen before. The disease produced a high fever, nasal congestion, and an obvious feature -a bright red nose. The disease was named Rhino- erythria (red nose disease). The organism that caused the disease was soon isolated and found to be a new species in the genus Bacillus, and the new species was named Bacillus rudolphia. Two authors of general biology lab manuals became interested in the disease and set out to find an antibiotic that could be used to treat the disease.* After an extensive search of the literature, they found that Antibiotic X has been effective against several species of Bacillus and they decided to try the antibiotic on the organism that caused Rhinoerythria. 1. State the question being studied in this research. T. LUL LI indep deper 5. For t that 6. If th resul expe hyp < > 1 MAR 12 Matv 0 platform.virdocs.com 13... VB Visible Body Suite VB Visible Body Course... Free Concepts of Bi... dShelf. eReader decided to try the antibiotic on the organism that caused Rhinoerythria. 1. State the question being studied in this research. 2. Write the research hypothesis being proposed for this research. *Actually, the disease is fictitious. The authors, however, are not. 6. You To You meth then using **This fore, Baha MAR 12 M tv J ocs.com ב Tue Mar 12 4:35 PM s of Bi... Ch. 1 Review Questi... Custom: Ebook: Los... Using examples, ex... EQTT : d on ed false en t nesis in. e- of f- any e uld 3. Sometimes researchers propose several different hypotheses-all possible answers they could come up with. Also, they often propose a null hypothe- sis, which states that the treatment has no effect on the outcome of the experiment. Thus, the results of the experiment support one hypothesis or the other. Write the null hypothesis for this research. 4. For this research, state the: independent variable: tes od dependent variable: Page 12 Go X irdocs.com cepts of Bi... Ch. 1 Review Questi... Custom: Ebook: Los... no- used new ב Tue Mar 12 4:35 PM Using examples, ex... = Q T : 5. For this research, state all of the control variables that you can think of. 1 was ase d the y h. 6. If this experiment were actually conducted, what results would you expect in the control and experimental groups if the original research hypothesis were accepted?** You Don't Need a White Lab CoatSee Answer
Q16: Homework Set 2 Name: 1. Draw a eukaryotic cell including 5 organelles or cell components – label each organelle/component and give one unique structural feature and one main function for each 2. Draw a membrane bilayer with an example of a) simple diffusion, b) facilitated diffusion, and c) active transport. For each type of transport: indicate what molecule solute is being transported (give an actual molecule that would be appropriate for that type of transport), indicate the relative solute concentration on each side of the cell membrane as it would appear before transport, and indicate the direction of solute transport. 3. The internal solute concentration of a red blood cell is about 2%. For each of the solutions below indicate whether it would be a hypotonic or hypertonic solution and explain what would likely happen to a blood cell if it were placed in each solution (use complete sentences and include the net movement of water in your answer) a. 0.5% Solute Solution b. 5% Solute Solution 4. Give an example of a spontaneous and an example of a non-spontaneous process or reaction from Chapters 2-7 (including what section or figure or slide the example is found). Provide one reason that the reaction is spontaneous or non-spontaneous (use complete sentences). 5. Using the illustration of oxidative phosphorylation below a) Label the places where NADH and FADH2 each donate their electrons to the electron transport chain. b) Show the path of electrons from their entry point to their final destination. c) What is the final electron acceptor? Label the final electron acceptor and the product it produces. d) Use arrows to indicate where protons (H+) are pumped across the membrane and the direction of movement of the protons. Label which side of the membrane is the area of high proton (H*) concentration and the area of low proton (H*) concentration. e) Use an arrow to indicate where protons (H+) re-cross the membrane down their concentration gradient h) What is the reaction that of proton (H+) flow from the area of high concentration to the area of low concentration provides energy for? Label the reactants and products for this reaction. Matrix ATP Synthase IV Intermembrane Space Du nofs Cyt C and what molecule is being Would this reaction, as written, be part of the citric acid cycle of cell respiration or 6. In the reaction below, what molecule is being oxidized reduced Calvin cycle of photosynthesis CH,O HOCH NADPH NADP+ U CH,O-P HOCH + P₁ CH 1,3-bisphospho- glycerate glyceraldehyde-3-phosphate (G3P) 7. The molecules O2 and CO2 are directly involved in both cell respiration and photosynthesis. In what stage of cellular respiration (glycolysis, citric acid cycle, oxidative phosphorylation) or photosynthesis (light reactions, Calvin cycle) are each being used or produced and describe what role they play in each situation. 02 Produced Used Role: Role: CO2 Produced Role: Used Role: 8. The following statements are all false. Pretend you have a friend that believes they are true - Write an explanation for why each is false to convince your friend of the correct answer (this has to be more than just stating the correct answer - explain where your friend is mistaken and provide reasoning for the correct answer; use complete sentences) Plants produce ATP by photosynthesis so they don't need to do cellular respiration Exergonic reactions (- AG) go from more stable, higher energy molecules to less stable, lower energy molecules Yeast cells in the absence of oxygen will stop doing glycolysis and do fermentation insteadSee Answer
Q17: Part I: General questions. Please pick 3 and write a short essay (no more than 350 words) about each. Please include drawings, if appropriate. Remember that compare and contrast means: tell me what they have in common, and what their key differences are. 2. Please compare and contrast transcription in prokaryotes and eukaryotes 3. Please discuss the ways in which gene expression can be controlled post- transcriptionally 6. Please discuss why mangroves are worth studying. What makes them unusual? What sorts of genes might be expressed differently when grown in fresh and salt water? How might mangroves benefit humans? Part II: More specific questions. Please pick 3 and write a short essay about each. Please include drawings, if appropriate. 1. Please compare the various classes of cloning vectors and discuss their uses. 4. Please describe initiation of transcription by RNA polymerase 2 and why it is so much more complex than other RNA polymerases. 6. Please compare and contrast translation in prokaryotes and eukaryotes.See Answer
Q18:3. The following metabolic pathway exists in a strain of bacteria. The bacteria require product D to survive. The three enzymes required to produce D are controlled by three separate genes (genes 1 to 3). A enzyme 1 B enzyme 2° C enzyme 3*D Assume that this pathway is under the control of an operon. a) In the space provided below, draw the operon for this biochemical pathway. [2 A] b)Illustrate a scenario when the levels of D are HIGH (i.e. the bacteria would not require the enzymes to produce D) [2 A] 4. The gel below, was produced by DNA sequencing. What was the original DNA template strand sequence? [4T] ddCTP ddGTP ddTTP ddATP | | |/n5. During an investigation of the promoter region of a gene you apply heat to two sections of DNA that you believe could be a promoter region. One region unwinds at 80 degrees Celsius and the other unwinds around 60 degrees Celsius. Which of the two strands contains the promoter? Explain. [4 T] 6. Use labelled diagrams incorporating the concept of the "Central Dogma of Molecular Genetics" to illustrate how a mutation can lead to disease. [4 C]See Answer
Q19: Imagine you have been recently hired by a biotech company. On your first day of work, the manager wants to see your ability to engineer proteins, so they ask you to design a protein expression system for making any protein you wish, but it should have some way after expression in E. coli BL21 to be purified by affinity chromatography. The manager gives you some advice and recommends you produce the protein with a HisTag so you can purify your protein with nickel affinity column chromatography which the company uses regularly. To make things easier since its your first day, the manager gives you a tube containing a proprietary expression vector that only your company has called pET 14p and it is this vector that you will need to use to insert the gene for the protein that you choose to make and purify. Before getting started on the actual experiments, the manager wants you to design the experimental setup and provide a report. The following 6 items (marked w/ **) should be included in your report along with an explanation for each step. Steps to follow in this design project for your report 1) Choose a protein that you are interested in purifying. -This can be any protein (there are millions possible so no two students would by chance choose the same protein) - You can use resources like NCBI (https://www.ncbi.nlm.nih.gov/protein/ ) or KEGG (https://www.genome.jp/kegg/pathway.html), among others to find a protein you are interested in making. **(List the name of the protein you plan to make and the organism it comes from) 2) Find the amino acid sequence of that protein and then find the DNA sequence needed to make that amino acid sequence. -The amino acid sequence may be found at the links above. DNA sequences may be found at NCBI or KEGG as well or deduce it here: https://en.vectorbuilder.com/tool/codon-optimization.html **(List the amino acid sequence and its corresponding DNA sequence for this protein you plan to make) 3) Choose a set of restriction enzyme that you can use to cut your pET14p expression vector but that will not cut the important protein coding regions of the gene you are inserting into pET14p -NOTE: You should make sure that the coding sequence of your selected protein you choose does not already contain the sequences recognized by those restriction enzymes you selected to cut your pET14p vector or else it will cut your gene at a place you don't want. You can use this tool http://nc2.neb.com/NEBcutter2/ to check if your gene (DNA sequence that codes for your protein of interest when translated) contains the sequences recognized by that restriction enzyme that you have chosen. If the gene does contain a sequence that will be cut by your enzymes selected to cut the pET14p vector then you'll either have to choose a different enzyme or select a different codon for those positions on that gene so that it can make the same protein but not be cut improperly by the restriction enzymes you plan to use. Because you will be expressing your protein for purification using Nickel affinity chromatography, make sure that your choice of cutting location does not remove the HisTag sequence from your vector. **(List the names of the restriction enzymes you will use to cut the pET14p vector and their recognition sites. Also show where in the pET14p vector that it cuts) 4) Imagine you have access to the DNA template of this gene. Choose the appropriate forward primer and reverse primer that you will need to PCR this gene from your template. Make sure that your primers have 5' ends that possess the corresponding restriction sites needed to later insert the PCR product into your pET14p vector. - NOTE: You will need your primers to have approximately the same melting temperature (within 2 degrees of each other) and they should be between 55°C to 65°C. You may find this tool useful http://www.biophp.org/minitools/melting_temperature/demo.php (you can select basic Tm). Remember that your reverse primer sequence would be the reverse complement of the gene sequence you had chosen (if you are looking at the coding sequence in the proper way) and as such you may find the following tool useful for getting the reverse complement: http://www.bioinformatics.org/sms/rev_comp.html **(Provide the forward and reverse primer DNA sequences from 5' to 3' and their expected melting temperature...underline the restriction sites on each primer) 5) Show your plasmid containing the recombinant DNA for your gene. Imagine that you have now conducted the PCR successfully with your primers on your gene of interest to get a PCR product and that you have cut the PCR product using the same restriction enzymes from step 3 that you used to cut the vector. After ligating the cut PCR product into the cut pET14p vector you will have a complete plasmid. **(Show what the DNA sequence will look like for the ligated DNA of your final complete plasmid but just show the region between the T7 promoter and T7 terminator after you have ligated your gene into the vector making sure to underline the restriction sites and placing in bold (or highlight in yellow) the new sequence of your gene that you inserted into the vector) 6) Assume you have now transformed E. coli with this complete plasmid DNA including your gene and it worked to make the protein that you wanted. Show the protein sequence of your final product that would result from expression of this plasmid. **(Show the translated DNA sequence from step 5 so please show the amino acid sequence of what your expressed protein would be. Remember that it will need to included the His-tag in the same frame so you must check if your open reading frame makes sense. You can use an online translation tool like: https://web.expasy.org/translate/. Show what the amino acid sequence will look like if you were to express this protein by translating the region between the first Methionine after the Ribosome Binding Site until you reach the first stop codon). If you do see a stop codon prior to that then your reading frame is likely mis-aligned and you will nee to re-adjust your forward PCR primer to either include an additional nucleotide or two nucleotides to get your insert it into the correct reading frame with the rest of your pET 14p vector. This additional nucleotide (or two) can be placed between the restriction site and the start of your gene when designing your forward primer. PET-14p sequence landmarks T7 promoter T7 transcription start His Tag coding sequence Multiple cloning sites (KpnI - Spe I) T7 terminator pBR322 origin bla coding sequence 646-662 645 554-571 510-526 404-450 Sca (4156) 2845 Pvu I(4046) 3606-4463 Pst I(3921) Eam1105 I(3676). HgiE II(3369) AlwN I(3199) Aat II(4598) Ssp I(4480) EcoR I(4669) Apo I(4669) Cla I(24) Hind III(29) <j「3606-4463) ori (2845) Bpu1102 I(458) Nhe I(229) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) Sph 1(874) EcoN I(934) -Sal I(959) PshA I(1024) PET-14P (4671bp) Eag I(1247) Nru I(1282) ApaB I(1360) BspLU11 I(2783) Afl III(2783) Sap I(2667) Bst1107 I(2554) BsaA I(2535) Tth111 I(2528) BsmB I(2424) Pvu Il(2374) BspM I(1362) Bsm I(1667) Msc I(1754) Bpu10 I(1889) Bsg I(1943) PET 14p Nhe I(229) BglII T7 promoter primer #69348-3 T7 promoter Bpu1102 I(458) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) XbaI You can check the sequence recognized by the restriction sites by searching the names of the enzymes on http://www.neb.com/ rbs means the ribosome binding site ▶rbs AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAAC GGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA NcoI His Tag Spe I Ball KpnI TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCC TGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGC TAAC AAAGCCCGA MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuVal ProArgGlySerThrSerGlyGInVal ProA laAlaAsnLysAlaArg Bpu1102 I thrombin T7 terminator AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC TAAACGGGTCTTGAGGGGTTTTTTG LysGluAlaGluLeuAlaAlaAlaThгAlaGluGInEnd T7 terminator primer #69337-3 Same as above but text can be copied for your convenience: AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGCTAACAAAGCCCGA AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGSee Answer
Q20:What role would tRNA play during the process of protein synthesis? O) brings the amino acid to mRNA ○ ) directs the mRNA to the ribosome O) Is part of the ribosome O) zips DNA back upSee Answer

TutorBin Testimonials

I found TutorBin Biology homework help when I was struggling with complex concepts. Experts provided step-wise explanations and examples to help me understand concepts clearly.

Rick Jordon

TutorBin experts resolve your doubts without making you wait for long. Their experts are responsive & available 24/7 whenever you need Biology subject guidance.

Andrea Jacobs

I trust TutorBin for assisting me in completing Biology assignments with quality and 100% accuracy. Experts are polite, listen to my problems, and have extensive experience in their domain.

Lilian King

I got my Biology homework done on time. My assignment is proofread and edited by professionals. Got zero plagiarism as experts developed my assignment from scratch. Feel relieved and super excited.

Joey Dip

Popular Subjects for biology

You can get the best rated step-by-step problem explanations from 65000+ expert tutors by ordering TutorBin biology homework help.

TutorBin helping students around the globe

TutorBin believes that distance should never be a barrier to learning. Over 500000+ orders and 100000+ happy customers explain TutorBin has become the name that keeps learning fun in the UK, USA, Canada, Australia, Singapore, and UAE.