https://publicpagestutorbin.blob.core.windows.net/%24web/%24web/assets/fi_9657202_87d8b572c8.png

Bioinformatics Homework Help | Bioinformatics Assignment Help

Improve your grasp of Bioinformatics concepts & excel in your academic career with the best expert team of TutorBin Bioinformatics homework help.

https://publicpagestutorbin.blob.core.windows.net/%24web/%24web/assets/fi_7564144_fcd8fdaa5d.png

Trusted by 1.1 M+ Happy Students

Place An Orderand save time
man
phone
*Get instant homework help from top tutors—just a WhatsApp message away. 24/7 support for all your academic needs!

Bioinformatics Homework Help- Expert Assistance For Assured Academic Success

Bioinformatics is an interdisciplinary field of science that combines biology, computer science, and mathematics to analyze and interpret biological data. It plays a crucial role in scientific research, especially in the realm of biomedicine. As a Bioinformatics student, you'll have to do challenging homework tasks that require a solid grasp of biological concepts and computational techniques. To empower you to excel academically, TutorBin provides dedicated support through Bioinformatics homework help assistance.

Our expert bioinformatics tutors are committed to guiding you through complex concepts, ensuring you establish a strong base in this subject. Whether you're tackling sequence analysis or the synthesis and replication of biomolecules, TutorBin is your trusted partner on the path to academic success. Our experienced tutors have years of expertise in DNA data analysis. They provide in-depth knowledge about gene transmission, DNA, RNA, protein structures, and methods for their synthesis and replication. With our Bioinformatics homework help, you will receive expert guidance through the complex world of biological data analysis and achieve excellence in your academic pursuits.

Bioinformatics Homework Help: Best Online Help For Students

To overcome the difficulties of Bioinformatics, TutorBin is your go-to platform for students seeking assistance. With our user-friendly interface and access to a team of expert tutors, TutorBin simplifies the understanding of Bioinformatics, making it more accessible and comprehensible for students. Whether you're struggling with molecular modeling or genomics, TutorBin expert guidance and clarifications ultimately enhance your proficiency in this complex subject.

TutorBin provides personalized assistance that caters to your specific needs. You can ask questions, clarify doubts, and get step-by-step guidance on your Bioinformatics assignments. Also, our platform provides a range of resources like video solutions and access to a library of solved question-answers to reinforce your learning. So, if you're looking for the best online help for Bioinformatics homework, TutorBin stands as your trusted choice. We provide in-depth clarity that enhances your understanding of this complex subject.

Bioinformatics Homework Help: Your Path to Success

Who Can Benefit From Our Bioinformatics Homework Help at TutorBin?

At TutorBin, we provide online Bioinformatics homework help to a diverse range of individuals and groups. Also, ensure that learners receive the support they need to excel in this multidisciplinary field. Let's explore who can benefit from our Bioinformatics assistance and how it can enhance their academic career.

1. For High School Students: Unlocking the Basics

High school can be an exciting yet challenging phase, especially when delving into complex subjects like Bioinformatics. We understand the need for accessible resources that simplify Bioinformatics concepts, making it easier for high school students to grasp the fundamentals. Our Bioinformatics homework help is customized not only to aid in excelling in high school coursework but also to provide a solid foundation for future studies in biology and computational biology. Whether you're working on high school assignments, our Bioinformatics assistance builds a strong foundation in this core subject.

2. For Undergraduate & Graduate Students: Navigating Complexity

The journey through undergraduate and graduate studies in biology, genetics, Bioinformatics, or related fields can be demanding. That's where TutorBin Bioinformatics homework help comes in. Our comprehensive support is crafted to help you guide you through the complexities of Bioinformatics with confidence. Whether you're exploring gene sequencing, protein analysis, or other advanced topics, our Bioinformatics tutors are here to enhance your academic journey and research capabilities.

Bioinformatics Tutors Online - Is It Worth To Hire Them?

Hiring our expert Bioinformatics tutors online is definitely worth it, as they're highly qualified and experienced in the field of Bioinformatics. They have in-depth knowledge of the subject to simplify complex concepts, provide valuable insights, and assist you in achieving a high level of proficiency in Bioinformatics. Whether your challenges lie in sequence or data analysis, our tutors employ proven methods and practical examples to clarify these challenging topics. Also, our tutors can tailor their teaching to your specific needs to develop problem-solving skills. This personalized approach ensures that you gain a comprehensive understanding of the subject matter.

Moreover, our tutors provide the flexibility for you to seek assistance at your preferred times, ensuring it aligns with your schedule. This flexibility allows you to effectively manage your academic commitments alongside other responsibilities, as you have the freedom to choose when you receive support from our tutors. Additionally, our tutors are always available to answer your questions and help you confidently resolve any doubts you may have.

Do My Bioinformatics Homework

Challenges Where Students Need Bioinformatics Assignment Help

Bioinformatics assignments can definitely be challenging for students. Here are some common challenges that students will face when working on Bioinformatics assignments:

1. Complexity of Biological Data

Bioinformatics involves working with complex biological data such as DNA sequences and protein structures. Understanding and manipulating this data can be difficult, especially for students without a strong background in biology.

2. Insufficient Knowledge of Diverse Subjects & Algorithmic

Bioinformatics is a multidisciplinary field that combines biology, computer science, and statistics. Students will struggle to integrate knowledge from these diverse areas in order to solve complex biological problems. This field involves crafting algorithms for tasks that demand significant mathematical and computational skills.

3. Limited Data Access and Software Skills

In Bioinformatics assignments, students may struggle due to limited access to large datasets and the requirement to use specialized software tools and programming languages. Learning to use these tools effectively can be time-consuming and challenging for beginners in programming.

4. Lack of Data Interpretation Skills

Analyzing biological data is one thing; interpreting the results is another. Students can find it challenging to draw meaningful biological conclusions from their analyses.

5. Bioinformatics Jargon

The field has its own set of specialized terminology and jargon. Students will find it challenging to understand and use this terminology correctly in their assignments.

Bioinformatics Topics & Concepts Covered

TOPICS CONCEPTS
Sequence Alignment Pairwise & Multiple Sequence Alignment
Genomics DNA Sequence Analysis
Transcriptomics RNA-Seq & Gene Expression Analysis
Proteomics Protein Identification & Mass Spectrometry
Structural Bioinformatics Protein Folding & 3D Structure Visualization
Metagenomics Metagenome Sequencing & Taxonomic Profiling
Phylogenetics Phylogenetic Trees & Molecular Evolution

Bioinformatics Homework Help

What Do You Get When You Pay Someone to Do My Bioinformatics Homework?

When you decide to pay someone to do my Bioinformatics homework for me, you're seeking the assistance of someone with specialized knowledge to help you in your assignments. Here's what you can expect to receive when you hire a Bioinformatics tutor:

1. Concept Clarification

Bioinformatics involves complex concepts. Our tutors can break down these concepts into understandable parts, ensuring you have a solid foundation and can apply your knowledge confidently.

2. Customize Research Guidance

Our experienced Bioinformatics tutors can provide personalized guidance throughout your research process. They can assist you in formulating research questions, crafting experiment designs, and conducting results analysis for your assignments.

3. Practical Application Insights

Our Bioinformatics experts can bridge the gap between theory and real-world application. They explain how the concepts you're studying are directly relevant in fields like drug discovery and disease research, providing a deeper understanding of the subject.

4. Troubleshooting & Debugging

Bioinformatics can be challenging, especially when dealing with coding and data analysis. Our experts can quickly troubleshoot bugging issues and provide efficient solutions in your analyses that will save your valuable time.

5. Documentation & Reports

Our experts can assist you in preparing well-structured documentation and reports. They ensure clarity, precision, and proper formatting in presenting your findings and insights, helping you convey your thoughts effectively.

TutorBin Bioinformatics Homework Help Benefits

At TutorBin, our Bioinformatics homework help is designed to provide you with a range of benefits that will enhance your academic journey and help you excel in this complex subject. Here's why students choose us for Bioinformatics homework help:

1. Expert Guidance For Personalized Learning

Our Bioinformatics tutors are highly qualified and experienced in the field, dedicated to helping you understand even the most complex Bioinformatics principles. They customize their teaching approach to address your requirements, ensuring that you receive the best support and guidance perfectly suited to overcome your specific challenges.

2. Comprehensive Explanation

We go beyond just providing answers; our tutors are committed to explaining the underlying principles and steps involved in Bioinformatics problems. This approach empowers you to gain a deeper understanding of the subject, fostering personal growth and expertise.

3. Error & Original work Solutions

We provide meticulously crafted solutions free of errors, with each step thoroughly explained for clarity and practical application. Our solutions are entirely original and devoid of Original work, maintaining academic integrity and guaranteeing their uniqueness.

4. Affordability

We offer competitive pricing, making our Bioinformatics homework help accessible to all students.

5. Timely Submissions

We understand the pressure of deadlines and commit to delivering your Bioinformatics homework on time, alleviating the stress associated with tight schedules.

6. Flexibility & Convenience

TutorBin offers the flexibility to access top-notch assistance services from the comfort of your home or anywhere with an internet connection. Our convenient scheduling allows you to choose the times that best suit your busy life, making learning seamlessly adaptable to your schedule.

7. Continuous Support & Revisions

If you have questions or need revisions, our professional Bioinformatics experts are readily available to provide ongoing support. Your satisfaction is our priority, and we are committed to ensuring your requirements are met to your satisfaction.

8. Stringent Secured account

We understand the importance of privacy. Your personal information and the details that you sought help with your Bioinformatics homework are safeguarded with the utmost Secured account. Your trust in TutorBin is our priority.

Bioinformatics Assignment Help - Immediate Help From Expert Tutors

Struggling with complex Bioinformatics concepts and problems? TutorBin provides immediate Bioinformatics homework help that's tailored to your needs. We understand the urgency when you're dealing with challenging assignments and tight deadlines, and that's why we're always ready to assist you promptly.

Our team of expert Bioinformatics tutors possesses an in-depth understanding of the subject, spanning from fundamental principles to the latest cutting-edge tools and techniques. They excel in simplifying even the most complex topics, ensuring that you can grasp them quickly and easily. We pride ourselves on our lightning-fast response times. When you reach out, we're right there to guide you when you need it the most.

Our personalized approach ensures that you not only grasp the subject but comprehend it thoroughly. Our tutors focus on interactive learning, actively engaging with you to answer your questions promptly and provide valuable insights. This interactive approach enhances your understanding of Bioinformatics, equipping you with the knowledge and skills you need to succeed. So, if you're looking for quick, reliable Bioinformatics help, TutorBin is your go-to destination for immediate response.

Bioinformatics Homework Help Online Worldwide

Bioinformatics students come from all corners of the globe, and their study schedules can be diverse. That's why we provide Bioinformatics homework help online, accessible worldwide, 24/7. Whether you're studying in the United States, the United Kingdom, Australia, or anywhere else, our services are available to you. We understand that Bioinformatics challenges can arise at any time, which is why our 24/7 availability ensures you can get help when you need it, regardless of your time zone.

You can access our platform from anywhere with an internet connection, making it convenient to seek assistance with your Bioinformatics homework from the comfort of your home. Our responsive customer support team is ready to assist you promptly, valuing your time and aiming for quick responses. With our worldwide, 24/7 Bioinformatics homework help, you can maximize your learning journey. We're here to support you, no matter where you are or what time it is.

Bioinformatics Help FAQs Searched By Students


Can I pay someone to do my Bioinformatics assignment?

Absolutely! At TutorBin, you can pay for our qualified tutors to handle your Bioinformatics assignment, leading to a better understanding and improved proficiency in the subject. Seeking assistance from online Bioinformatics tutors can significantly enhance your academic growth.


Where can I find someone reliable to do my Bioinformatics assignment?

You can find reliable Bioinformatics assignment help from our team of experts who specialize in Bioinformatics and can assist you with your assignments effectively.


Can experts provide me with a well-researched Bioinformatics assignment solution?

Yes, our experts are equipped to deliver well-researched and tailored Bioinformatics assignment solutions that meet your specific requirements.


Are there online Bioinformatics homework helpers available?

Yes, at TutorBin, you'll find online Bioinformatics homework helpers who can assist you with your assignments and provide valuable support.


Can I get instant Bioinformatics assignment help in the USA?

Of course, we provide instant Bioinformatics assignment help in the USA through our 24/7 online platform. Our Bioinformatics tutors are available around the clock to assist you.

Recently Asked Bioinformatics Questions

Expert help when you need it
  • Q1:B. Briefly describe Ensembl: what it is, what information it holds, and which other entities are like it See Answer
  • Q2:Recombinant DNA You have received a PCR product from an unknown organism that caused fever and a strange rash in young child. The family of the child has two kittens, and the physician treating the child suspects an infection with Bartonella. Strangely, the growth characteristics do not match those of known Bartonella species. The clinical lab has amplified an 825 base pair fragment of the unknown organism's genome and has asked you to use the PCR product to investigate the identity of the unknown bacteria. Once you received the DNA you decided to have the PCR product sent out for sequencing. Bioinformatics 1) Using a Blastn search determine the top 3 most similar DNA sequences and using Blastx determine the top 3 most similar proteins. What gene did the clinical lab PCR amplify? • What is the function of the protein? • Based on the results from this gene what organism did you isolated? And what species is your organism most similar to?See Answer
  • Q3:PCR/Primer Design and Cloning Now that you have learned a little bit about the genetics of the unknown organism you have been asked to create a real-time PCR assay to detect the unknown in other patient's blood samples using the gene that was amplified by the clinical lab. To create your standards for your real-time PCR assay you need to clone your DNA fragment into a plasmid (pUC19) using standard PCR techniques. 2) Using the 825 bp sequence for your unknown fragment, please create a primer pair that will amplify a 500 base pair fragment of the gene. Additionally, please add restriction sites to the ends of your primers. Please provide the following: • Sequences of the primers • Primer Tm • The location of the primers in the sequence • The restriction sites you used. Remember: Check to make sure that the restriction sites will only cut the primers and are not found anywhere else in the DNA sequence but are found in pUC19.See Answer
  • Q4:Part 1: Smith-Waterman Algorithm Instructions: 1. Copy the "STS protein query sequence" from the week 3 links page (This is the one letter code for the protein encoded by the Resveratrol synthase gene, the gene that catalyzes the final step in the resveratrol synthesis pathway). Be sure to include the ">STS query" on the first line, or the program won't accept it. 2. Go to https://www.ebi.ac.uk/Tools/sss/ and choose SSEARCH, then "protein". This will do a Smith-Waterman local alignment on your protein sequence. 3. Choose the UniProtKB/TrEMBL database (under Step 1 on the page) 4. Paste the STS protein query sequence into the paste window 5. Choose SSEARCH under step 3, then click "More options". Here you will find a number of parameters including the substitution matrix. Search UniProt using three different substitution matrices: • BLOSUM 50 • PAM 120 • PAM 250 Be patient, the calculation will take a while. Questions: 1. What is the name and score of the best hit for each matrix? 2. What is the e-value of the best hit for each matrix? 3. Why do you think the results may have changed? 4. What do e-values mean and how do we interpret them?See Answer
  • Q5:Part II: Needleman-Wunsch Algorithm Instructions: 1. Go to https://www.ebi.ac.uk/Tools/sss/ and select GGSEARCH then protein. This will do a Needleman-Wunsch global alignment on your protein sequence. 2. Choose UniProtKB/TrEMBL as your database (step 1) 3. Paste in your STS protein query sequence (step 2) 4. Click More options... on step 3 and choose BLOSUM50 as your scoring matrix and then click Submit. Questions: 1. What is the name and score of your top hit? 2. How do these results differ from what you got with the Smith-Waterman algorithm (SSEARCH)? 3. Why do you think the results differed?See Answer
  • Q6:Part III: FASTA Algorithm Instructions: 1. Go to https://www.ebi.ac.uk/Tools/sss/ and select FASTA, then protein. 2. Choose UniProtKB/TrEMBL as your database (step 1) 3. Paste in your STS protein query sequence (step 2) 4. Click More options... on step 3 and run your queries for the following choices of parameters: Scoring Matrix BLOSUM 50 BLOSUM 80 BLOSUM 80 BLOSUM 80 Gap Open -10 -10 0 -64 Gap Extend -2 -2 0 -16/nQuestions: 1. Did these calculations take as long as the Smith-Waterman search? If so, why? 2. Were the results different from the Smith-Waterman search? Why do you think this happens? 3. What is the effect of changing to a higher cutoff BLOSUM matrix (i.e. from 50 to 80) and what does it mean? 4. What is the effect of changing the Gap Open and Gap Extend parameters? Why do you think you observed what you did?See Answer
  • Q7:Part IV: using BLAST Instructions: 1. Go to http://blast.ncbi.nlm.nih.gov/Blast.cgi 2. Click on nucleotide BLAST. 3. Copy STS mRNA query sequence from the week 3 links page then paste it into the Query sequence window (note that this is a nucleotide sequence). 4. Under Database, choose Standard databases 5. Choose optimize for somewhat similar sequences (blastn) under Program selection, (note this is not the default) then click BLAST. 6. Now, run the same query against the expressed sequence tags database (est). (Database "Others", then scroll to "expressed sequence tags") Questions: 1. What are the names, scores, and e-values of your best hits for the two different searches you just performed? 2. Why are these results so different?See Answer
  • Q8:Part V: Comparing FASTA and BLAST and SSEARCH Instructions: 1. Go to https://www.ebi.ac.uk/Tools/sss/ 2. You will do a nucleotide search using the STS mRNA from the previous step using FASTA, BLAST, and SSEARCH. 3. Leave the database as the default setting. 4. Select FASTA as your program, select more options, and set the following parameters: 5. Match/Mismatch: +3/-2 6. Gap Open: -5 7. Gap Extend: -2 8. Run the search and note the name, score, and e-value of the best hit. 9. Repeat this for BLAST and SSEARCH. Questions: 1. What were your best hits for each of the different search algorithms? 2. Were they different and if so why? 3. Why was it necessary to set the parameters as described above before running the searches?See Answer
  • Q9:Part I: Learning about molecular phylogenies 1. What is the basic assumption underlying a molecular phylogeny? Why must we distinguish between gene trees and species trees? 2. 3. Why don't genes always evolve by a series of bifurcations (i.e., by a series of single base changes)? 4. What are the four steps to constructing a molecular phylogeny? 5. What is an orthologous sequence? 6. What is a paralogous sequence? 7. What is a xenologous sequence? 8. Which type of sequences should you use for a species phylogeny? 9. What is the difference between multiple sequence alignments to discover motifs, etc., vs for constructing phylogenies? 10. Why is Clustal W not a very good choice for constructing species phylogenies?/n10. Why is Clustal W not a very good choice for constructing species phylogenies? 11. Please use the supplemental material on the links page to answer the following questions. What is a phylogenetic tree composed of? What is the difference between rooted and unrooted phylogenetic trees? What are the two major groups of analyses used to examine phylogenetic relationships? 0 0 0 What is a paraphyletic grouping? What happens if a multiple alignment is poor? What is the best way to deal with parts of an alignment that are uncertain due to gaps? What sorts of phylogenies are best constructed using DNA sequence alignments? What sorts of phylogenies are best constructed using protein alignments? What sorts of phylogenies are best constructed using ribosomal RNA sequence alignments? 0 0 0 0 0 What is a homoplasy? 0 Why can't we simply construct all possible trees, score each one, then pick the one with the best score? 0See Answer
  • Q10:Part II: Distance matrix methods 1. Answer the following questions: What is the general approach used by distance matrix methods to construct a phylogeny? a. b. 2. 3. 4. a. 5. a. b. 6. What are the main differences between UPGMA and neighbor-joining methods? Take your protein sequences from the links page and import them into Mega. Align them via Clustal W and save the alignment. Use your alignment to construct UGMA and Neighbor-Joining Trees. What are the differences and similarities between the trees? Repeat the above with an alignment based on MUSCLE instead of ClustalW. How does this change the results? Why do you think the results are different? Include labeled screen shots of your different trees.See Answer
  • Q11:Part III: Maximum parsimony methods 1. 2. 3. 4. What is the key assumption of maximum parsimony methods? How does this differ from distance matrix methods? What are the advantages of maximum parsimony methods? What are the disadvantages of maximum parsimony methods?See Answer
  • Q12:Part V: Tree evaluation 1. 2. 3. 4. 5. What are the three basic ways to resample the data for tree-building? What is jackknife resampling? What is bootstrap resampling? How does it differ from jackknife resampling? Recreate one of your ML trees except use Bootstrap Resampling as a method of tree evaluation. 6. How did your tree change?See Answer
  • Q13:3. RNAFold also uses partition-function methods (AKA thermodynamic ensemble methods). What is a partition function and how is it related to free energy? What are the advantages and disadvantages of calculating partition functions?See Answer
  • Q14:1. For BLAST/FASTA tell us how many significant results were found, and which sequences were most closely related and who they came from. Identify and try to explain any unexpected similarities and any differences between the searches using DNA versus amino acid sequences.See Answer
  • Q15:3. For PSI-BLAST etc tell us how many more distant relatives were found, what sorts of organisms they came from, and what sorts of proteins were related. Identify and try to explain any unexpected results.See Answer
  • Q16:4. For VAST (or the other structural alignment programs) tell us what sorts of proteins you found, and whether you found any new ones missed by the sequence-based approaches. Discuss any differences from the sequence-based approaches, and dentifySee Answer
  • Q17:5. For Clustal W describe the relationships that were identified, and what parts of the protein were related. Identify and try to explain any unexpected results.See Answer
  • Q18:Note: Calculate RF for all populations with two linked OR unlinked genes. Population Name: Practice population 1 Trait 1 - Dominant/Recessive - Yes/No Dominant form: Trait 2- Dominant/Recessive - Yes/No (Supporting Cross = Vial Location of gene: Autosome X Chromosome (Supporting Cross = Vial Dominant form: Location of gene: Autosome Codominant - Yes/No Recessive form: Codominant - Yes/No Recessive form: Are the two genes linked? Yes/No Recombination frequency between genes: Codominant form: Codominant form: (Supporting Cross = Vial X Chromosome (Supporting Cross Vial (Supporting Cross = Vial (Supporting Cross = VialSee Answer
  • Q19: Introduction to Biotechnology 2024 LAB 5 Worksheet DNA is a long polymer of four distinct nucleotides, which exists as a double stranded helical molecule. The four nucleotides are abbreviated as A, C, G, T. Their sequence in double-stranded DNA varies as it goes along. Occasionally, and purely by chance, there occurs in the DNA what are called palindromic sequences of nucleotides. These are symmetrical sequences, which read the same forward as they do backward on the opposite strand of DNA. Two examples of these palindromic sequences are highlighted in the sequence below. TTAGAAGCTTTTATCCGTAAAAGAATTCCTTTCAGAAACGCGGAT..etc AATCTTCGAAAATAGGCATTTTCTTAAGGAAAGTCTTTGCGCCTA..etc In bacteria, palindromic sequences are recognized by specific enzymes whose purpose in nature is usually to destroy DNA. These enzymes are called endonucleases. Each restriction enzyme has a highly specific shape, so it can only stick to certain sequences of letters in the DNA code. This is called a "recognition sequence” or "restriction site”. If its "recognition sequence" is present, the enzyme will be able to Bind to the recognition sequence on each of the DNA strands and cut the DNA in a very specific way. For example, when EcoRI recognizes and cuts this site, it always does so in a very specific pattern that produces ends with single-stranded DNA “overhangs” (Figure 1): AATTC 5' 3' GAATTC CTTAAG 3' 5' S' 3' G G CTTAA EcoRI enzyme Figure 1 EcoRI restriction pattern Page 1 of 5 mis 3' 5' Introduction to Biotechnology 2024 Exercise 1: (a) Study the DNA sequence below carefully. It's a length of linear double-stranded DNA (both strands are shown). Find and indicate on the sequence where the restriction endonuclease EcoRI will cut the DNA (i.e. search the DNA for the palindromic sequence required for recognition by the enzyme EcoRI). The hyphen means that the DNA continues onto the next line. TTAGAAGCTTTTATCCGTAATAAGGAATTCCTTTCAGAAACGCGGATACCCCCGTA- AATCTTCGAAAATAGGCATTATTCCTTAAGGAAAGTCTTTGCGCCTATGGGGGCAT- TTATCCGTAAATGGATTTCAGAAACGCGGATACCAATTCCGAGAAATAAAGGCCCG- AATAGGCATTTACCTAAAGTCTTTGCGCCTATGGTTAAGGCTCTTTATTTCCGGGC- ATACTTATCCGTATAAAGGATTCCAGAACGCGGATACCAATTCCGAATTCATAAAG- TATGAATAGGCATATTTCCTAAGGTCTTGCGCCTATGGTTAAGGCTTAAGTATTTC- TATTAGGCTGCTAGCTAGCGCTAGATCGCAGTCGTAGCTAGTCGTAGCGCGCGTAT- ATAATCCGACGATCGATCGCGATCTAGCGTCAGCATCGATCAGCATCGCGCGCATA- ACGCGGATACCAATTCCGAATTCATAAAGAGTCGTAGCTAGTCGTAGCGCGCGAAA TGCGCCTATGGTTAAGGCTTAAGTATTTCTCAGCATCGATCAGCATCGCGCGCTTT (b) How many times does the EcoRI site occur in the sequence above? (c) If the DNA sequence above was treated with EcoRI, how many fragments of DNA will result? (d) How long will each resulting fragment of DNA be after cutting with EcoRI? Count the bases pairs in each. (Note: a base pair is two bases bonded to one another) Page 2 of 5 Introduction to Biotechnology 2024 (e) Indicate in the gel below the pattern of DNA fragments which you would see after the digest was run on an electrophoresis gel. Indicate the size (bp) of each of the fragments Direction of electrophoresis Exercise 2: The restriction enzymes EcoRI, HindIII and BamHI were used to cut lambda DNA. The restriction site for each enzyme is shown here, indicated by the arrow. EcoRI 5....GAATTC.....3' 3.....CTTAA G......5 1 ↓ HindIII 5.A AGCTT....3° 3....TTCGA A...5' ↑ BamHI 5...G GATCC.....3° 3.....CCTAG G.....5 Page 3 of 5 Introduction to Biotechnology 2024 21226 7421 23130 9416 6557 bp 16841 4361" 7233 3383 6770 6627 6626,5506 ||| 0.7% agarose 5804 5643 4878 3530 1.0% agarose 564 125 1% agarose EcoRI HindIII BamHI Figure 2 Expected restriction patterns of lambda DNA cut with various restriction enzymes Figure 2 above shows the size of each of the fragments/bands produced when lambda DNA is cut with each of these restriction enzymes. The sizes were determined by comparison to a molecular ladder. Figure 3 below represents complete lambda DNA sequence and indicates the total number of base pairs (bp) it contains (48502 bp). Samples labelled A, B and C represent lambda DNA cut with one of the three restriction enzymes (EcoRI, HindIII and BamHI) where the lines indicate the DNA being cut by the enzyme. Use these diagrams to answer the following questions. ADNA 0 10,000 20,000 30,000 40,000 48,502 (bp) A 5505 22,346 27,972 34,499 41,732 (bp) 1 B 21,226 26,104 31,747 39,168 44,972 (bp) C 23,130 27,479 36,895 37,584 44,141 25,157 37,459 (bp) Figure 3 Complete lambda DNA sequence (48,502 bp) and lambda DNA cut with 3 different restrictions enzymes (A, B, C). Page 4 of 5 Introduction to Biotechnology 2024 (a) Calculate the size the resulting fragments will be after digestion by each enzyme A, B and C and complete the table below. lambda DNA cut with enzyme A List fragment sizes in decreasing order of size lambda DNA cut with enzyme B lambda DNA cut with enzyme C List fragment sizes in decreasing order of size List fragment sizes in decreasing order of size (b) How many fragments would you expect to see for each of the DNA sequences cut with an enzyme A, B and C on the agarose gel? (c) Compare the size of the fragments that you have calculated with the bands shown in the Figure 2 and determine which of the enzymes (BamHI, EcoRI and HindIII) are A, B and C. (d) How many times does the sequence GAATTC occur in the lambda DNA sequence? What about AAGCTT and GGATCC? Page 5 of 5See Answer
  • Q20:Part I: Finding specific types of prokaryotic sequences 1. Why is it relatively easy to find genes in bacterial genomes? 2. Go to the week 7 folder, select E.coli, then copy the entire DNA sequence. These are the first 10,000 bp of the raw E.coli genomic DNA sequence that we are going to study using various DNA analysis programs. 3. Go to http://www.fruitfly.org/seq tools/promoter.html paste the sequence into the window, then select "Prokaryotic," "yes" for "include reverse strand?" and click "submit." • How many promoters does it find on the forward strand? • Where do the three highest-scoring promoters start and end? • How many promoters does it find on the reverse strand? • Where do the three highest-scoring promoters start and end? 5. Go to BPROM - Prediction of bacterial promoters (softberry.com) and click "help.” • How accurate is BPROM? • How far is it from most bacterial promoters to the protein coding sequences? 6. Return to BPROM - Prediction of bacterial promoters (softberry.com) paste the E. coli query into the window then click "process." 4. How many promoters does it find? 5. Where do the three highest-scoring promoters start and end? 6. How do these compare with the previous site?See Answer
View More

Popular Subjects for Bioinformatics

You can get the best rated step-by-step problem explanations from 65000+ expert tutors by ordering TutorBin Bioinformatics homework help.

Get Instant Bioinformatics Solutions From TutorBin App Now!

Get personalized homework help in your pocket! Enjoy your $20 reward upon registration!

Claim Your Offer

Sign Up now and Get $20 in your wallet

Moneyback

Guarantee

Original Work

Reports

$20 reward

Upon registration

Full Privacy

Full Privacy

Unlimited

Rewrites/revisions

Testimonials

TutorBin has got more than 3k positive ratings from our users around the world. Some of the students and teachers were greatly helped by TutorBin.

I was struggling with my Bioinformatics assignments, but TutorBin came to the rescue. Their expert tutors provided me with clear explanations and tailored guidance. Thanks to their help, I not only completed my assignments but also gained a deeper understanding of the subject. I highly recommend TutorBin for Bioinformatics support!

Liam

TutorBin Bioinformatics homework help has been a game-changer for me. The tutors are knowledgeable and patient, and they always go the extra mile to ensure I grasp the concepts. My confidence in Bioinformatics has soared, and I'm grateful for the excellent support I received.

Mia

I was hesitant to seek help with my Bioinformatics assignments, but TutorBin made the process easy and stress-free. Their tutors are friendly, and the solutions provided are error-free and original. TutorBin has been a reliable companion on my academic journey.

Aiden

Bioinformatics was a challenging subject for me, but TutorBin made it manageable. Their Bioinformatics homework help was convenient, and the tutors were available round the clock. The assistance I received was personalized to my needs, making learning enjoyable and effective.

Isabella

I can't thank TutorBin enough for their Bioinformatics support. The timely submissions and affordable pricing were a huge plus. The tutors not only helped me complete my assignments but also helped me gain a solid foundation in Bioinformatics. I wouldn't have achieved academic success in this subject without TutorBin.

Richard

TutorBin helping students around the globe

TutorBin believes that distance should never be a barrier to learning. Over 500000+ orders and 100000+ happy customers explain TutorBin has become the name that keeps learning fun in the UK, USA, Canada, Australia, Singapore, and UAE.